Construction method and application of CRX gene deletion mutation cat mutant
A construction method and gene deletion technology, applied in the fields of biology and genetic engineering, can solve the problem of retinal degeneration model, and achieve the effect of improving the efficiency of gene editing, reducing the experimental process, and simplifying the operation process.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Design, construction, in vitro transcription and verification of transgenic target vectors
[0036] sgRNA sequence design:
[0037]According to the cat CRX gene sequence information provided by the NCBI, the target site sequence 5'-TGGCGGCCGGCCCCCTCTCTGA-3' (SEQ ID NO:2) was selected based on the cat CRX gene Exon4, and the DNA sequence of the sgRNA that identified this site was 5'-gggcggggctggtggccc-3' (SEQ ID NO:9). According to the requirements of the T7 promoter in vitro transcription kit used (purchased from Vazyme), the sgRNA in vitro transcriptional sequence is designed: TAATACGACTCACTATAgggggctggtggcc GTTTAGA (SEQ ID NO:3), Design sgRNA complementary sequence: AAAAAAGCACCGACTCGGTCCACTTTCAAGTTGATAACACTACTTAACTTACTTACTT(SEQ ID NO:4), including sgRNA PCR amplification primers F:GGATCCTAATACGACTCACTATAG (SEQ ID NO:5) and sgRNA PCR amplification primer R:AAAAAAGCACCGACTCGG (SEQ ID NO:6).
[0038] sgRNA synthesis in vitro:
[0039] According to the designed sgR...
Embodiment 2
[0047] Example 2: simultaneous estrus treatment of cats and CRX gene knockout cat embryo transfer
[0048] Cat contemporal estrus regimen:
[0049] Select adult female cats (6 months of age and older) with normal posture and no disease, and determine that their last estrus period is at least 2 weeks apart from this contemporaneous estrus time. On the first day, 2-4 pm intramuscular prostaglandin 100 IU is injected for two consecutive days at an interval of 24H; on the third day, 200 IU PMSG is injected intramuscularly at 1 pm, at an interval of 74 h, 100 IU hCG is injected and the male in estrus is combined and mated naturally.
[0050] Cat special period fertilized egg acquisition protocol:
[0051] The Chinese pastoral female cat, which is treated in estrus at the same time, is used as a fertilized egg donor and as an embryo transfer receptor for experiments. After natural mating, the fertilized embryos are washed away. The M2 manipulation solution is used as the ovulation fluid...
Embodiment 3
[0061] Example 3: CRX gene knockout cat gene mutation detection
[0062] After the kitten is born, tail tissue is collected for identification. Scrape as small tissue as possible under the microscope (closer to the cell size the better) into 1 ul of PBS, then add 1 ul protease K water bath 55 °C lysis 0.5 h, 95 °C inactivation for 2 min. After lysis, the sample was cat genomic DNA.
[0063] PCR using cat genomic DNA as a template with the primers are:
[0064] Forward Primer F:5'-GCACAAACCAAGGCTCGTCC-3' (SEQ ID NO:7);
[0065] Reverse primer R:5'-GATCCAGGCCAVTGAAATAGGAG-3'(SEQ ID NO:8),
[0066] Amplification sgRNA recognition cleaves DNA fragments totaling 331 bp upstream and downstream of the target. The PCR amplification of the fragment of interest was sequenced for DNA sequencing, and the cat CRX gene sequence provided by the NCBI database was compared to determine the mutation type of the CRX gene.
[0067] After sequencing and sequence information comparison, 2 male cats in ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



