Camel-source high-affinity nano antibody for SARS-CoV-2alpha mutant strain and SARS-CoV-2beta mutant strain

[0075] Example 1. Construction of SARS-CoV-2 Nanobody Library

[0076] Take 200ug of SARS-CoV-2 virus original strain S protein and RBD protein (Beijing Yiqiao Shenzhou Biological Co., Ltd.) and mix it with an equal volume of complete Freund's adjuvant, fully emulsify and inject it into camels, and then boost the immunization every two weeks. Among them, the mixture of incomplete Freund's adjuvant and immunogen was used in booster immunization, and subcutaneous immunization on the back of the neck was performed at multiple points for a total of 5 times. From the third immunization, blood was collected from the jugular-clavicular vein one week after each immunization and serum titers were detected.

[0077] Leukocytes were isolated from the peripheral blood after the fifth immunization, total RNA was extracted, and the VHH gene was cloned by reverse transcription PCR and nested PCR (wherein, the systems and parameters of reverse transcription PCR and nested PCR are described below) Fragment, the sticky ends were modified with the restriction endonuclease SfiI, the VHH gene fragment was ligated to the phagemid pComb3Xss by T4 ligase (a gift from the laboratory of Prof. Bruce D Hammock, UC Davis), and the high-efficiency electroporation was transformed into E. coli ER2738 (laboratory) Preservation, or commercially available, for example, from NEB, UK), to construct a phage nanobody library of SARS-CoV-2. It has been determined that the primary library has a capacity of 10 9cfu, add helper phage (multiplicity of infection: 20:1) M13KO7 (purchased from NEB Company, product number: N0315S) for rescue, and obtain a phage nanobody library with a library capacity of 10 12 pfu/mL, the diversity of the library is better.

[0078] reverse transcription PCR:

[0079] Reverse Transcription Kit using PrimeScript TM RT-PCR Kit, purchased from Takara Company, commodity number: AK2701.

[0080] The reverse transcription system is as follows:

[0081]

[0082] 65 ℃, the reaction 5min. Take it out and put it on ice, add samples according to the following system, and carry out cDNA first-strand synthesis.

[0083]

[0084] 30°C for 10 minutes; 42°C for 1 hour; 72°C for 5 minutes.

[0085] Nested PCR: (purchased from TAKATA company, item number: 6210A)

[0086] The first round of PCR:

[0087] The reaction system is as follows:

[0088]

[0089]

[0090] The reaction procedure is as follows:

[0091]

[0092] Second round of PCR:

[0093] The reaction system is as follows:

[0094]

[0095] The reaction procedure is as follows:

[0096]

[0097] Nested PCR primer sequences are as follows (5'-3'):

[0098] GSP-RT: CGCCATCAATRTACCAGTTGA (SEQ ID NO: 23)

[0099] LP-leader: GTGGTCCTGGCTGCTCTW (SEQ ID NO: 24)

[0100] F: CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC (SEQ ID NO: 26)

[0101] R: CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGC TGTGGTGCG (SEQ ID NO: 25)

[0102] Among them, R represents the base A/G, W represents the base A/T, and K represents the base G/T.

[0103] Example 2. Screening of SARS-CoV-2 Nanobodies

[0104] The first well of a 96-well microtiter plate was coated with the S protein antigen of the original strain of SARS-CoV-2 at a concentration of 1ug/mL, overnight at 4°C; the next day, the coating solution was poured out and washed with PBST for 3 The first and second wells of the ELISA plate were blocked with BSA and incubated at room temperature for 2 hours; the blocking solution was poured out and washed 3 times with PBST; the phage nanobody library obtained in Example 1 was added to the first well and reacted for 2 hours ; Pour out the liquid, pat dry on clean absorbent paper, and wash 5 times with PBST; add 100 μL of SARS-CoV-2 virus original strain S1 protein to the first well, and react for 1 h; aspirate out the first well The liquid was added to the second well, reacted for 1 h, and the phage bound to BSA was removed; the eluate was collected, and 5 μL was used for titer determination, and the rest was used for amplification.

[0105] The phage eluate was added to fresh Escherichia coli ER2738 bacterial solution (preserved in the laboratory, also commercially available, such as purchased from NEB company), 37 ° C, and let stand for 15 min; add carbenicillin and SB medium, 37 ° C, 220rpm, cultured for 2h; add helper phage M13KO7 (multiplicity of infection MOI=20:1) (purchased from NEB company, product number: N0315S) and kanamycin, culture overnight; the next day, centrifuge to get supernatant, add PEG-NaCl solution Precipitate purified phage.

[0106] The amplified product was screened in the next round to ensure that the addition amount of each round of screening was the same, the antigen coating concentration and the S protein competitive elution concentration were decreased by 2 times, the titer of each round was calculated, and a single clone was picked for amplification and purification. ELISA identification. Positive single clones were obtained after 3 rounds of panning.

[0107] Example 3. Expression of SARS-CoV-2 Nanobodies

[0108] The positive monoclonal plasmid was extracted, transformed into E. coli TOP10F' competent cells (purchased from ThermoFishier), and then spread on solid medium for overnight culture after recovery. The next day, a single clone was picked and cultured in SB-carboxybenzyl medium, and IPTG was added to induce overnight expression; the next day, the cells were lysed with a high-pressure homogenizer, filtered through a membrane, and purified with a nickel column, that is, using a histidine tag to bind with the cells. The nanobodies were separated and purified by affinity chromatography of nickel chloride in the nickel column to obtain high-purity anti-SARS-CoV-2 nanobodies, namely antibodies A1-A6. After amino acid sequencing analysis, the amino acid sequences of the obtained nanobodies were as shown in SEQ IDNO: 1-6.