New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA
A non-coding, Streptococcus mutans technology, applied in the field of oral disease treatment and prevention, can solve the problem of lack of ideal caries treatment effect Streptococcus mutans mutant strains, etc., to reduce the number, prevent the occurrence and development, and adjust the oral flora imbalance. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Analysis of clinical isolates
[0039] To isolate and collect dental plaque from caries-free / severe young children with caries, culture and isolate Streptococcus mutans by conventional means in the prior art, and use conventional RT-qPCR to detect AsvicK (antisensevicK RNA, ASvicK) in the isolated Streptococcus mutans. ) relative expression, the experimental results are as follows figure 1 As shown, the figure shows the relative expression of ASvicK in dental plaque in caries-free children (CF) and severe young children with caries (SECC) (n=8; * means p less than 0.05). The expression of ASvicK was increased in caries-free children, suggesting that ASvicK is closely related to cariogenicity.
[0040] RT-qPCR primers are as follows:
[0041] First-strand synthetic translation primer: 5'-TCACGTATTGATAATCAGACCAGTC-3';
[0042] Sense strand PCR primer: 3'-GTCGTTAGTTGATTATTCCAAATGC-5'
[0043] (ie: 5'-CGTAAACCTTATTAGTTGATTGCTG-3').
Embodiment 2
[0044] Example 2: Construction of ASvicK Overexpression Strain (Antisense vicK Gene Mutant Strain)
[0045] (1) Construction of recombinant plasmid
[0046] The long non-coding RNA (ASvicK) used in this protocol is named antisense vicK RNA (antisensevicK RNA, ASvicK). The secondary structure prediction results of ASvicK are as follows figure 2 shown. The gene sequence of ASvicK is shown in SEQ ID NO.1 (5'→3'):
[0047] TTTCAATCCAAACTGATTTGTCAGGATAATCTCTAATAATTTCGTAAACCTTATTAGTTGATTGCTGACTTTGAATTTGATCAAAGCGATCCAGAATATAATTCATAAAAGCTGTAAAATTCGTCAATTCAACATCTAGATGACTGGTCTGATTATCAATACGTGATAAGCTAAGTAAATCAGTAATCATACGCATCATGCGATTAGTCTCATCAAGTGATACCTTGATAAAGCTAG(SEQ ID NO. 1);
[0048] The sequence of the vicK gene is shown in SEQ ID NO.2 (5'→3'):
[0049] ATGACTAATGTGTTTGAATCAAGTCCCTTATTTTTACGAATTTTATTAGCAGTTTTAATCATTTTACTCTTTTTTTATTTTATTTTTCTCAATTACAGAGAGTATAAAAATAATAATCAAGTTAAACAGTTAAATGCTAAAGTACGTTCTTTGATTACTGGCCATTATACTGATAAATTAAAGGTTGAGGATAACTCTGACTTGTCAGAACTAGTGAATAACGTTAATG...
Embodiment 3
[0059] Example 3: Experiment on biofilm performance of mutant strains
[0060] Bacterial biofilm (or Bacterial biofilm, BF) refers to a large number of bacterial aggregated membranes formed by bacteria that adhere to the contact surface, secrete polysaccharide matrix, fibrin, lipid protein, etc. thing. The polysaccharide matrix usually refers to the polysaccharide protein complex, and also includes the organic matter and inorganic matter precipitated from the surrounding. Bacterial biofilm is a life phenomenon that is beneficial to the survival of bacteria in order to adapt to the natural environment. It is formed by the accumulation of microorganisms and their secretions.
[0061] The biofilm formation ability of the mutant strains was detected by crystal violet staining. After the three strains were stained with crystal violet, the absorbance value at 595 nm was measured, and the experimental results were as follows Figure 7 shown. Compared with UA159, the total amount ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


