Trimutant of recombinant human interleukin-2 and its preparation method

A technology of interleukin and mutants, applied in the fields of botanical equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of many background proteins, troublesome purification, low expression level, etc., and it is not easy to achieve Aggregation and precipitation, improved stability, and improved activity

Inactive Publication Date: 2005-06-29
CHONGQING UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this system itself has several defects: ① As a prokaryotic expression system, it lacks post-translational modification and processing of eukaryotic proteins, such as cleavage, glycosylation, and formation of disulfide bonds; It exists in the form of inclusion bodies, and requires complex renaturation to restore conformation and activity; ③ There are many background proteins, and purification is troublesome; ④ The expression level is generally not very high
Such as lack of strong promoters, poor secretion efficiency, unstable expression strains, easy loss of expression plasmids, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trimutant of recombinant human interleukin-2 and its preparation method
  • Trimutant of recombinant human interleukin-2 and its preparation method
  • Trimutant of recombinant human interleukin-2 and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment I

[0027] 1. Cloning and amplification of three-site mutation hIL-2 gene and construction of pPIC9K plasmid

[0028] We designed and automatically synthesized in a DNA synthesizer by the phosphite triester method, purified by 20% acrylamide 7mol / L urea denaturing gel to obtain four primers, primer 1, 5′GCG AAGTCAGTGTTGAGATGATGCTTTG AAAGG3', Primer2, 3'CTGTAAATCAGACAAATTAAATG5', Primer3, 5'GCACGT AGCACCTACTTCAAGTTCTAC 3′, Primer 4, 5′ GCATTTA TCTGATTTACAG 3'. Primer 1 contains EcoR I restriction site, stop codon, 125 Ala and a complementary sequence of the amino acid coding gene at the 3′ end of mature human IL-2, a total of 43 bases, primer 2, a total of 22 bases, primer 3 contains a SnaB I restriction site, start codon and mature hIL -2 The amino acid coding sequence at the 5′ end, with a total of 33 bases, primer 4 is a mutation primer, in which 18 and 19 leucines are mutated into 18 Met, 19 Ser, a total of 22 bases. The full-length cDNA sequence of hIL-2 was amplifi...

Embodiment II

[0087] 1. Purification and activity determination of three-site mutant rhIL-2

[0088] The purification of rhIL-2 is mostly limited to extraction from Escherichia coli. It is the first time to express and purify secreted natural and mutant rhIL-2 with Pichia pastoris. Purifying three-site mutant rhIL-2 from this expression system is a A whole new process of exploration. We explored a set of the simplest and fastest purification steps.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a triple mutant of recombinant human interleukin-2 and a preparation method thereof. The purpose is to transform human interleukin-2 (hIL-2) by means of genetic engineering, and prepare three-site mutant interleukin-2 Proved to be 4.3 times more active than natural human interleukin. By obtaining the three-site mutant interleukin-2 cDNA, constructing the pPIC9K-IL-2-3m plasmid, and then transforming it into KM71 Pichia pastoris, and obtaining the three-site mutation from the pPIC9K-IL-2-3m KM71 yeast fermentation supernatant Site mutations in the interleukin-2 protein. That is, the 18th, 19th and 125th amino acids of natural interleukin-2 are replaced by methionine, serine and alanine respectively.

Description

Technical field: [0001] The invention relates to a mutant of recombinant human interleukin-2 and its preparation method Background technique: [0002] Human interleukin-2 (hIL-2) has three cysteine ​​residues, among which the cysteines at positions 58 and 105 form intramolecular disulfide bonds, and the sulfhydryl group at position 125 is free. Through the method of site-directed mutagenesis Substitution of cysteine ​​at position 125 with serine or alanine increases its activity. The activity of the substitution of cysteine ​​at position 125 with other amino acids was almost unchanged. Although the biological activity of cysteine ​​58 or 105 substitutions was reduced, mutants with cysteine ​​58 were more than 20-fold less active than mutants with cysteine ​​105 . It is possible that the amino acid sequence around cysteine ​​58 plays an important role. In contrast, the amino acids around position 105 are much less important in the structure-function of hIL-2. On the othe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/55C12N15/26C12P21/02
Inventor欧阳克清胡应和蒋红诗李新平刘堰蔡绍皙陈荣高唐宜国
OwnerCHONGQING UNIV