Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing antigen protein in use for hog cholera vaccine

A technology for antigenic protein and swine fever vaccine, which is applied in the directions of biochemical equipment and methods, botanical equipment and methods, and applications, to achieve the effects of low nutritional requirements, rapid growth of prokaryotes, and high-density fermentation and culture

Inactive Publication Date: 2005-12-21
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the invention is to solve the problem of mass production of antigenic protein for genetically engineered vaccines for swine fever

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing antigen protein in use for hog cholera vaccine
  • Method for producing antigen protein in use for hog cholera vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036]1. Extraction of CSFV RNA from selected CSF strains

[0037] Through the analysis of the genetic derivation relationship of the E2 gene of the epidemic strain of classical swine fever, the current dominant epidemic strain or the strain with a broad antigen spectrum was selected as the virus material. In this example, the epidemic strain of classical swine fever GXYL / 2000 was selected as the virus material, from which the classical swine fever virus RNA was extracted. Using the extracted viral RNA as a template, the E2 gene was obtained by reverse transcription (RT), and then amplified by polymerase chain amplification reaction (PCR) and multi-nested polymerase chain amplification reaction (nPCR). Record-polymerase chain amplification reaction is called RT-PCR for short.

[0038] E2 gene RT-PCR primers are as follows: E21 (forward) 5'TGTATTGACCAGACTGG 3'

[0039] E2 1' (reverse) 5'CTGCCAACCGCCGTCTATCTT 3'

[0040] E2 gene nPCR primers are as follo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
strengthaaaaaaaaaa
impedanceaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for producing an antigenic protein for a swine fever vaccine. The specific steps include: extracting viral RNA from a swine fever strain, obtaining the immune gene E2 of the swine fever virus through reverse transcription; using the E2 gene as a template, performing polymerase chain reaction Reaction, at the same time, optimize the codon of the E2 gene according to the codon preference of Pichia pastoris, and then insert it into the expression vector of Pichia pastoris through the restriction site; introduce the recombinant expression vector into Pichia pastoris, and screen out the recombinant Pichia pastoris Red Saccharomyces; identify the expression product of recombinant yeast, and detect the immune activity of the expression product, and determine the selected recombinant yeast; test and analyze the culture conditions of the selected recombinant yeast, and select the optimal culture condition; The recombinant yeast is cultivated under the condition to produce the antigenic protein for the vaccine.

Description

technical field [0001] The invention relates to a method for producing an antigenic protein for a swine fever vaccine, in particular to a method for producing an antigenic protein for a genetically engineered vaccine for swine fever by using a Pichia pastoris expression system. Membrane glycoprotein (gp55) gene (E2) yeast system expression vector, with the help of cell bioengineering technology, the recombinant expression vector integrated into the Pichia pastoris chromosome can efficiently express foreign genes in high-density cultured host bacteria, and can Antigens for the production of swine fever vaccines. Background technique [0002] Classical swine fever (CSF) is an infectious disease caused by classical swine fever virus that seriously endangers the lives of livestock and pigs. The World Organization for Animal Health (OIE) listed it as a Class A infectious disease. my country is a country with serious swine fever epidemics. Every year, pigs that die due to this d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/81C12P19/34C12P21/00
Inventor 刘湘涛韩雪清谢庆阁尚佑军
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com