Therapeutic uses of keratinocyte growth factor-2

A technology of cell and cell proliferation, which is applied in the field of protection or treatment of bladder and prostate, and can solve problems such as damage to the mucosal surface and avulsion

Inactive Publication Date: 2001-05-16
HUMAN GENOME SCI INC
View PDF47 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during sinus surgery, the mucosal surface can be avulsed or damaged

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Therapeutic uses of keratinocyte growth factor-2
  • Therapeutic uses of keratinocyte growth factor-2
  • Therapeutic uses of keratinocyte growth factor-2

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0147] Epitope-bearing peptides and polypeptides of the invention can be produced by any conventional method for preparing peptides or polypeptides, including recombinant methods using nucleic acid molecules of the invention. For example, short epitope-bearing amino acid sequences can be fused to larger polypeptides that can be used as vectors during recombinant production and purification, and to generate anti-peptide antibodies during immunization. Epitope-bearing peptides can also be synthesized using known chemical synthesis methods. For example, Houghten described a simple method for the synthesis of large numbers of peptides, as 10-20 mg of 248 different peptides representing single amino acid variants of a segment of the HA1 polypeptide were prepared and characterized (by ELISA-type binding studies) within 4 weeks. 13-residue peptides, Houghten, R.A (1985), A general method for rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody int...

Embodiment 24

[0250] In Example 24, the effect of KGF-2 on the proliferation rate of normal rat salivary and lacrimal gland cells was studied. There are three major salivary glands in mammals: the parotid, sublingual, and submandibular salivary glands. A single intravenous injection of KGF-2 induced an approximately 40-fold increase in the proliferation of serous cells in the parotid gland, an 18-fold increase in the proliferation of serous and mucous cells in the submandibular gland, and a 10-fold increase in the proliferation of serous cells in the lacrimal gland. KGF-2-induced increased salivary and lacrimal cell proliferation was reversible.

[0251] KGF-2 significantly increased the proliferation of normal serous and mucus secreting cells in normal rat salivary and lacrimal glands, but did not appear to elicit a proliferative response in ductal cells (see Example 24). This effect on the salivary and lacrimal glands was reversed after removal treatment, suggesting that KGF-2 is safe an...

Embodiment 1

[0325] Bacterial expression and purification of embodiment 1KGF-2

[0326]The DNA sequence ATCC #75977 encoding KGF-2 was first amplified with PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed KGF-2 cDNA (including the signal peptide sequence). The 5' oligonucleotide primer contained the sequence 5'CCCCACATGTGGAAATGGATACTGACACATTGTGCC3' (SEQ ID NO. 3), which contained an AflIII restriction enzyme site including and followed by the KGF-2 coding sequence starting from the putative start codon. 30 nucleotides of the sequence. The 3' sequence 5'CCCAAGCTTCCACAAACGTTGCCTTCCTCTATGAG3' (SEQ ID NO. 4) contains the complement of the HindIII site followed by 26 nucleotides of KGF-2. These restriction enzyme sites are compatible with those on the bacterial expression vector pQE-60 (Qiagen, Inc. Chatsworth, CA). pQE-60 encodes antibiotic resistance (AMpr), a bacterial origin of replication (ori), IPTG-regulated promoter operator (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thicknessaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the administration of Keratinocyte Growth Factor-2 (KGF-2) to stimulate proliferation of platelets and to increase levels of fibrinogen, albumin, globulin and total serum protein. Further, the present invention relates to administering KGF-2 to protect or treat the bladder and prostate. Moreover, the present invention relates to administering KGF-2 to stimulate growth of nasal, oral, and esophageal mucosa, lacrimal glands, salivary glands and Goblet cells.

Description

field of invention [0001] The present invention involves the administration of keratinocyte growth factor 2 (KGF-2) to stimulate platelet proliferation and increase fibrinogen, albumin, globulin and total serum protein. In addition, the present invention relates to the administration of KGF-2 for the protection or treatment of bladder and prostate. Furthermore, the present invention relates to the administration of KGF-2 to stimulate the growth of nasal, oral and esophageal mucosa, lacrimal glands, salivary glands and goblet cells. Background of the invention [0002] Thrombocytopenia is a pathological condition in which the number of platelets in circulating blood is abnormally reduced (Stedman's Medical Dictionary, 26th edition, Marjory Spraycar, Editor (1995)). Thrombocytopenia can have various causes, but ultimately results from platelets being destroyed, pooled in the body, or not being produced. The differential diagnosis of thrombocytopenia is broa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09A61K38/00A61K48/00A61P1/00A61P7/00A61P7/04A61P7/06A61P11/00A61P11/02A61P13/08A61P13/10A61P27/02A61P27/16A61P35/02C07K14/475C07K14/50
CPCC07K14/50A61K38/00A61P1/00A61P11/00A61P11/02A61P13/08A61P13/10A61P27/02A61P27/16A61P35/02A61P7/00A61P7/04A61P7/06C07K14/475
InventorP·吉姆尼兹M·A·拉姆派D·曼德里克D·拉塞尔A·路易
OwnerHUMAN GENOME SCI INC