Check patentability & draft patents in minutes with Patsnap Eureka AI!

Utilization of ADAMTS-1 protein and method of screening aggrecanase activity regulator

A technology of aggrecan and protein, which is applied in the field of ADAMTS-1 protein use and aggrecanase activity regulator screening, which can solve the problems of low aggrecanase activity, abnormal cartilage remodeling, etc.

Inactive Publication Date: 2003-06-25
KUREHA KAGAKU KOGYO KK
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] In addition, it is known that the activity of aggrecanase is reduced, which can cause abnormal cartilage remodeling (i.e., destruction and regeneration of cartilage)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Utilization of ADAMTS-1 protein and method of screening aggrecanase activity regulator

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Hereinafter, the present invention will be specifically described based on examples, but the present invention is not limited to these. Example 1 (1) The recombinant human ADAMTS-1 protein was prepared using the base sequence shown in sequence number 1 of the sequence list: gtggcggccgcggctccaatg cagcgagctgtg and the base sequence shown in sequence number 2 of the sequence list: cactctagactccagccttct Reverse primers composed of tgctttccctg and human spleen cDNA library (Marath on-Ready cDNA; Clonetec Lab., Inc.; Palo Alto, California, U.S.). According to conventional methods, the human ADAMTS-1 was isolated by polymerase chain reaction (PCR) Protein gene (cDNA of approximately 3kbp). The base sequence of the obtained cDNA was analyzed, and the result was consistent with the base sequence of the human ADAMTS-1 gene described in JP 11-46781 A.

[0053] Next, after cutting the ends of the above cDNA with restriction endonuclease Xbal and restriction endonuclease Notl, agarose g...

preparation Embodiment 1

[0064] The recombinant ADAMTS-1 protein-containing component prepared in Example 1 (1) above was dissolved in physiological saline and the amount of ADAMTS-1 protein was 25 mg / mL, and then the obtained recombinant ADAMTS-1 protein solution was transferred to The ampoule tube is sealed to prepare the pharmaceutical composition of the present invention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A novel use of ADAMTS-1 protein or its functionally equivalent modifications; medicinal compositions for treating or preventing diseases caused by abnormal chondral remodeling, medicinal compositions for normalizing abnormal chondral remodeling, and medicinal compositions for decomposing aggrecan, each containing, as the active ingredient, ADAMTS-1 protein or its functionally equivalent modifications; and a method whereby an aggrecanase activity regulator useful in treating or preventing diseases caused by the depression or acceleration of aggrecanase activity can be screened. ADAMTS-1 protein or its functionally equivalent modifications are usable in producing drugs for treating or preventing diseases caused by abnormal chondral remodeling, drugs for normalizing abnormal chondral remodeling or drugs for decomposing aggrecan.

Description

Technical field [0001] The present invention relates to the use of ADAMTS-1 protein and a method for screening aggrecanase activity regulators when manufacturing pharmaceuticals for the treatment and prevention of diseases caused by abnormal cartilage remodeling. Background technique [0002] ADAMTS-1( a d isintegrin a nd m etalloproterinase with t hrombo s Pondin type lmotifs) protein is the earliest protein discovered in the ADAMTS family with metalloprotease activity and thrombospondin type 1 motif. [0003] The ADAM family is a protein group with a single-chain snake venom polypeptide domain and a metalloprotease domain. Its nucleic acid and amino acid sequences are very similar to those of the single-chain snake venom polypeptide of snake venom and the nucleic acid and amino acid sequences of metalloprotease (J. Cell Biol., 131, 275-278, 1995; Cell, 90, 589-592, 1997; Immunol. Today, 278, 278-284, 1999). When the ADAM family was discovered, it was believed that the single-c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/50A61K38/00A61K38/48A61P19/02A61P19/04A61P43/00C12N9/50C12Q1/37G01N33/15G01N33/573
CPCA61K38/4886G01N33/573A61P19/02A61P19/04A61P43/00
Inventor 广濑国孝久野耕嗣松岛纲治
Owner KUREHA KAGAKU KOGYO KK
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More