Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probe sequence for qualitatively detecting transgenic crop containing cauliflower mosaic virus 35S promotor using fluorescence PCR and reagent kit

A cauliflower leaf, qualitative detection technology, applied in the direction of microbial measurement/testing, biochemical equipment and methods, etc., can solve the problems of not expressing protein or unstable expression

Inactive Publication Date: 2010-11-17
QIAGEN SHENZHEN CO LTD +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For the detection of protein, serological methods are mainly used. Since some transgenic products do not express protein or the expression level is unstable, serological detection methods are only used in the detection of individual transgenic products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe sequence for qualitatively detecting transgenic crop containing cauliflower mosaic virus 35S promotor using fluorescence PCR and reagent kit
  • Probe sequence for qualitatively detecting transgenic crop containing cauliflower mosaic virus 35S promotor using fluorescence PCR and reagent kit
  • Probe sequence for qualitatively detecting transgenic crop containing cauliflower mosaic virus 35S promotor using fluorescence PCR and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0076] Preparation of purified water

[0077] Distilled with tap water once, purified by a Millipore MILLI-Q PF PLUS water purifier, collected water with a resistivity ≥ 18.0MΩ.cm, and stored in a sterile bottle.

[0078] Preparation of positive control substance

[0079] Take the corresponding positive sample, and extract the DNA with the CTAB method sample processing reagent, and amplify the above-mentioned prepared DNA with a primer longer than the detection reaction amplification fragment (using dTTP instead of dUTP), using Promega's Wizard PCRPreps DNA Purification System kit was used to purify the target nucleic acid fragments in the above PCR products, and then 1.5% agarose gel electrophoresis was used to roughly quantify the purified amplification products, and then the target fragments were purified by Promega’s PGEM-TEasy Vector System II kit. Connect with the T vector; then transform the connected product into JM109 competent cells, and then use X-Gal and IPTG agar...

Embodiment 1

[0133] Select genetically modified and non-genetically modified agricultural products such as soybeans, corn, rape, tomatoes, and potatoes, and extract genomic DNA with the Promega magnetic bead method, specifically: weigh 100 mg of plant material and place it in a 2ml centrifuge tube; add 500ul LysisBuffer A and 5ul RNase A, mix with the material; add 250ul Lysis Buffer B, mix well, and let stand at room temperature for 10 minutes; add 750ul precipitation buffer, mix well and centrifuge at high speed (13000×g) for 10 minutes; draw the supernatant into a clean 2ml centrifuge tube , add 50ul magnetic powder solution, and mix well; add 0.8 volume of isopropanol to the mixture, mix well, and let it stand at room temperature for 5 minutes; put the centrifuge tube on the magnetic rack for 1 minute, remove the clarified liquid; take out the centrifuge tube, and then add 250ul Lysis Buffer B, mix well and place on the magnetic rack for 1 minute, remove the clarified liquid; wash the m...

Embodiment 2

[0146] The 5' end of the above probe 35s7248FAMB was labeled with biotin, and the 3' end was not labeled; the 5' end of the primer 35s7345r was labeled with fluorescein. The probes were pre-coated on the ELISA plate with avidin.

[0147] The DNA in the sample was extracted according to conventional methods (CTAB method or magnetic bead method). Consists of 10×PCR buffer, dNTPs, Mg 2+ , Taq enzyme, upstream and downstream primers, H 2 O, and a DNA template to form a PCR reaction system for amplification.

[0148] After the amplification is completed, denature the amplified product into a single strand and add it to the enzyme-linked plate coated with the probe. If there is specific amplification, one strand of the amplified product will hybridize with the probe, wash the plate, and add Enzyme-linked fluorescein antibody, wash the plate, add color reagent, develop color for 10 minutes, stop color development, read the OD value on the microplate reader, and judge the negative ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

A fluorescence PCR qualitative determination for transgene crop probe sequence containing cauliflower mosaic virus 35S promoter gene and reagent kit thereof, the probe sequence includes, the probe sequence formed in the region by the extension of the sequence tgcctctgccgacagtggtcccaa upstream by 5 bases and downstream by 5 bases. The reagent kit comprises nucleic acid extraction reagent, and nucleic acid amplification reagent, the nucleic acid amplification reagent comprises 35sPCR reaction solution, 18s-rRNAPCR reaction solution, Taq enzyme (5U / ul), UNG (1U / ul), and comparison article. The detecting sensibility of the reagent kit to the transgene crops to the cauliflower mosaic virus 35s promoter gene can reach 0.1%, and has good sensibility and specificity, As the plant endogenous gene 18S-rRNA is used as an internal standard in the reagent kit, false negative can be prevented, and as the result of real time monitoring to the PCR product, testing time is saved substantially, manpower and expenditure consumption is also reduced.

Description

technical field [0001] The invention relates to a fluorescent PCR qualitative detection probe sequence and kit for transgenic crops containing cauliflower mosaic virus 35S promoter. Background technique [0002] According to the statistics of the International Agricultural Biotechnology Application Consulting Service Center (ISAAA), in 2001, the planting area of ​​transgenic crops in the world was 52.6 million hectares, and more than ten countries have planted transgenic crops, 99% of which were planted in the United States, Argentina, Canada and the United States. In China, commercialized genetically modified crops have been approved for commercialization, including soybean, corn, rapeseed, cotton, tomato, potato, sweet pepper, zucchini, papaya, sugar beet, carnation, petunia, flax, tobacco, watermelon, chicory, etc. Nearly 90 species have been planted. It is estimated that there are nearly 10,000 kinds of food produced and processed with these genetically modified crops i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 朱文斯朱水芳黄茜华
Owner QIAGEN SHENZHEN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com