Specific antibody of tumor-associated antigen SM5-1 and use thereof

A specific and antibody technology, applied in the field of tumor immunology, which can solve the problems of unsatisfactory specificity and neutralization ability of monoclonal antibodies

Active Publication Date: 2005-02-02
SHANGHAI SINOMAB BIOTECHNOLOGY CO LTD
View PDF19 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, although many monoclonal antibodies for immunotherapy of malignant tumors have been prepared, the specificity and neutralizing ability of these monoclonal antibodies are not ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific antibody of tumor-associated antigen SM5-1 and use thereof
  • Specific antibody of tumor-associated antigen SM5-1 and use thereof
  • Specific antibody of tumor-associated antigen SM5-1 and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] Screening and identification of huSM5-1 antigen

[0148] 1. Construction of cDNA library of hepatocellular carcinoma cell line QYC

[0149] Total RNA was extracted from human hepatocellular carcinoma cells QYC (purchased from Shanghai International Cooperative Cancer Institute) with Trizol reagent. Isolate mRNA and synthesize cDNA according to the method reported in the literature (Marken JS. PNAS, 1992, 89: 3503-3507), fill in and connect with the adapter of the BstXI restriction site, and clone into a mammalian transient expression vector after digestion with BstXI Escherichia coli MC1061 / P3 (purchased from Invitrogen) was electrotransformed into pCDM8 (purchased from Invitrogen) to form a cDNA library.

[0150] 2. Library expression and screening

[0151] The cDNA library constructed above was used to transfect COS-7 cells (Invitrogen) according to lipofectin method. After 12 hours, trypsinize the cells and place them on a new culture dish. 72 hours ...

Embodiment 2

[0155] Screening of huSM5-1 variable region gene from human antibody library

[0156] According to Marks et al. J. Mol. Biol., 222, 581-597; Hoogenboom and Winte, J. Mol. Biol., 227, 381-388; Haidaris CG et al., J Immunol Methods. 2001 Nov 1; 257(1-2 ): 185-202; Griffiths, A.D. et al. EMBO J., 13, 3245-3260 (1994); Nissim, A. et al. EMBO J., 13, 692-698 (1994) to construct human antibody libraries.

[0157] Add 1 ml of the revived antibody library strain to 14 ml of fresh LB medium, and culture in a 50 ml Erlenmeyer flask at 37°C for 16 hours.

[0158] The bacterial solution was centrifuged at 12,000 rpm for 10 minutes at high speed, and the supernatant was transferred to a sterile 50 ml centrifuge tube, and stored for later use. Its titer should be 2×10 11 above. A 25 ml cell culture flask was coated with the antigen A230 (SM5-1) purified in Example 1. Add no less than 3×10 10 Phage particles were incubated at 37°C for 1 hour. Then, the liquid in the bottl...

Embodiment 3

[0166] Preparation of huSM5-1 monoclonal antibody

[0167] 1. Construction of huSM5-1 expression vector

[0168] The XbaI restriction site and the signal peptide of monoclonal antibody OKT3 were added to the 5' end of the heavy chain variable region gene of huSM5-1 by PCR, and the NheI restriction site was added to the 3' end. The amino acid sequence of the signal peptide of monoclonal antibody OKT3 is MDFQVQIFSFLLISASVIISRG (SEQ ID NO: 13), and its nucleotide sequence is ATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATATCCAGAGGAG (SEQ ID NO: 14). The above PCR products were cloned into pGEM-T vector for sequencing confirmation. The heavy chain variable region was digested with XbaI and NheI and inserted into the pMG18-3K expression vector shown in Figure 1 (from Development of tools for environmental monitoring based on incp-9 plasma sequences. A. Greated, R. Krasowiak, M. Titok, C.M.Thomas school of biological sciences, university of Bermingham, Edgba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention discloses a new specific antibody (humanized monoclonal antibody huSM5-1 and human-mouse chimeric antibody SM5-1) specific for melanoma, breast cancer and hepatocellular carcinoma, and its related antigen encodes the Isolated nucleic acid molecules of antibodies, and methods of making said antibodies. The present invention also relates to the application of the antibody and / or isolated nucleic acid molecule in the preparation of medicaments for diagnosing and treating malignant tumors.

Description

technical field [0001] The invention belongs to the field of tumor immunology, and specifically relates to an antigen specifically present in melanoma, breast cancer and hepatocellular carcinoma, its specific monoclonal antibody, and the application of the monoclonal antibody to the diagnosis of tumors related to its specific antigen and / or methods of treatment. Background technique [0002] Malignant tumors are one of the major diseases that endanger human health. Among them, melanoma, hepatocellular carcinoma and breast cancer are the most common malignant tumors. [0003] Malignant melanoma is a highly malignant tumor that occurs in the head and neck, accounting for about 20% of the whole body, and mainly occurs in the skin, cavity, and sinus mucosa. Human malignant melanomas often begin as harmful nevi that, stimulated by radiation, grow to form destructive metastatic melanomas. Melanoma is very easy to spread to the whole body, and it is difficult to control clinicall...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/395C07H21/04C07K16/30C12N5/06C12N15/09
CPCC07K2317/565C07K2317/92C07K2317/21C07K2317/734C07K16/3053C07K16/303C07K2317/732A61K2039/505C07K16/3015C07K2317/73C07K2316/96C07K2317/24C07K2317/56C07K16/30A61P35/00
Inventor马菁
OwnerSHANGHAI SINOMAB BIOTECHNOLOGY CO LTD