Method for extablishing polymorphism adenoid tumour mouse model
A gonad and model technology, applied in the field of transgenic technology, can solve the problems of no overall animal level research report, lack of molecular mechanism research, no pleomorphic adenoma animal model, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Construction of MMTV-PLAG1 plasmid
[0043] Use the following primers, primer PLAG381: 5'-TTACGACCACATGAAACTTGAG-3' (SEQ ID NO: 2), primer PLAG2003: 5'-TGAATCCATGTCCCAGAATCCT-3' (SEQ ID NO: 3), to total RNA in human salivary adenoma or placenta The cDNA obtained by reverse transcription was used as a template, and the human PLAG1 gene was obtained by conventional RT-PCR method. Then cloned directly into pGEM-Teasy vector (Promega) to obtain plasmid pGEMT-PLAG1.
[0044]MMTV-EGFR-stop (Xie W, Paterson AJ, Chin E, et al. Targeted expression of a dominant negative epidermal growth factor receptor in the mammary gland of transgenic mice inhibits pubertal mammary duct development. Mol Endocrinol. 1997; 11(12): 1766 81) Contains the MMTV LTR promoter. Cut MMTV-EGFR-stop with EcoRI, excise the EGFR gene, recover the vector fragment and dephosphorylate it with CIAP (bovine pancreatic alkaline phosphatase); cut pGEMT-PLAG1 with EcoRI, and recover the PLAG1 gene fragment; use ligase ...
Embodiment 2
[0046] PLAG1 was introduced into mouse fertilized eggs by microinjection and the production of transgenic positive mice
[0047] After the transgenic plasmid MMTV-PLAG1 was linearized with XhoI, the fragment (4.3kb) containing the MMTV LTR and PLAG1 genes was recovered. Linearized DNA (about 500 copies) was injected into the male pronucleus of a mouse fertilized egg, and the injected fertilized egg was transplanted to a pseudopregnant mouse. About 20 days later, the mice were born.
[0048] Three weeks after the mice were born, their tails were cut to extract DNA to analyze whether there was transgene integration: After two sets of PCR reactions were used for detection, the primers are shown in Table 1. The β-globulin gene contained in the MTV-PLAG1 plasmid was used as a probe to confirm by Southern blotting.
[0049] serial number
Sequence (5’-3’)
SEQ ID NO:
1
GenBank Number: U65002
1
2
TTACGACCACATGAAACTTGAG
2
...
Embodiment 3
[0053] The expression of transgene in mouse salivary gland
[0054] In order to detect whether the MMTV LTR / PLAG1 fusion gene is expressed in mice, Trizol reagent was used to extract total RNA from mouse salivary glands according to conventional methods. Take 20mg RNA for electrophoresis and transfer to nitrocellulose membrane, use PLAG1 gene fragment as probe for Northern blot hybridization.
[0055] It was found that PLAG1 transgene was expressed at a high level in 5 of the transgenic mouse lines ( figure 2 ).
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com