Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof

A nuclear factor and anti-nuclear factor technology, which can be applied in the fields of peptide sources, drug combinations, animal/human peptides, etc., can solve problems such as difficult to achieve, and achieve the effect of broad market prospects and wide application value.

Inactive Publication Date: 2005-10-26
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is difficult to achieve this goal by interfering with the upstream pathway of NF-κB activation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof
  • Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof
  • Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Fusion expression and purification of nuclear factor-κB p50 subunit binding peptide and GST

[0033] According to the gene sequence of the binding polypeptide, while keeping the coding sequence of the polypeptide protein gene unchanged, according to the codon preference of Escherichia coli, design and synthesize the complementary DNA fragments with the upstream gene sequence containing BamH I and the downstream gene sequence containing Sal I cohesive ends , the DNA sequence is as follows, and the DNA sequence was synthesized by Shanghai Biological Engineering Co., Ltd.

[0034] FP:

[0035] 5'-GATCAACACTTGGGGTATGCTGAGCCTGCGTATCATCGTTCGCCTGGTTCGTCGTAACTCCTACTACCGTCGTAACTCCTACTACGGCACCCAGGACAACAGCCACCTGGCACGCGTTCACTTCCTGCTG-3'

[0036] RP:

[0037] 5'-TCGACAGCAGGAAGTGAACGCGTGCCAGGTGGCTGTTGTCCTGGGTGCCGTAGTAGGAGTTACGACGGTAGTAGGAGTTACGACGAACCAGGCGAACGATGATACGCAGGCTCAGCATACCCCAAGTGTT-3'

[0038]Dissolve the above DNA sequence with sterile double-distilled wate...

Embodiment 2

[0039] Example 2, Biosensor (Biosensor) detects GST-binding peptide fusion protein and nuclear factor-κB p50 subunit combination of

[0040] Put the carboxymethyl dextran biosensor chip into the microfluidic chuck of the Iasys Plus system, rinse with 60 μl PBS / T (pH7.4PBS, 0.05% Tween 20) for 3 times, equilibrate for 10min, and collect after the baseline leveled off Baseline data for 5 minutes; mix EDC and NHS at a ratio of 1:1, take 40 μl of the mixed solution to wash the sample pool twice, then add 40 μl of the mixed solution to the sample pool, and keep it for 7 minutes to activate the surface of the sensor sheet; use 50 μl of PBS / T Rinse the sample pool 3 times to collect the baseline value for 1 min; wash the sample pool with 40 μl of 10 mM pH5.5 acetate buffer solution for 3 times, then add 40 μl of acetate buffer solution, and collect the baseline value for 1 min; then add 40 μl of acetate buffer solution to the sample pool The total amount of dilution is about 0.5 ...

Embodiment 3

[0043] Example 3, ELISA method to detect the specific binding of GST-binding peptide fusion protein and nuclear factor-κB p50 subunit

[0044] Wash the coated wells of the ELISA plate with deionized water several times, invert the plate, and tap the plate on a clean filter paper to remove the remaining water; dilute the p50 protein with PBS buffer solution at a concentration of 10 μg / ml; add 100 μl of the diluted p50 protein Put it into the coated wells of 96-well ELISA plate, incubate at room temperature for 3-4 hours or overnight at 4°C, pay attention to the evaporation of water; wash the wells with 300 μl PBS three times to remove unbound p50 protein; prepare 5% aqueous solution of skimmed milk powder , add 200μl to each well, incubate at room temperature for 1h or incubate overnight at 4°C to seal the coated well; use protein binding buffer (50mM Tris-HCl, pH7.2, 100mM NaCl, 10mM MgCl2, 10uM ZncL2, 1mM DTT, 0.1% (v / v) NP40) Wash the plate 5 times; add 0.5 μmol / L GST-bin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to nuclear factor-K Bp50 subunit conjugated peptide, its preparation and application, in more concrete, it is a small polypeptide which can be specifically conjugated with nuclear factor-k Bp50 subunit and can be used for inhibiting its activity. Its amino acid sequence can be referred to sequence table.

Description

technical field [0001] The invention relates to the field of medicine, in particular to a nuclear factor-κB (NF-κB) p50 subunit antagonistic peptide for treatment, more specifically, to a peptide capable of specifically binding to the nuclear factor-κB p50 subunit and inhibiting it. Active small molecule peptides. The invention also relates to the preparation and application of the nuclear factor-κB p50 subunit antagonistic peptide. Background technique [0002] NF-κB is a transcription factor ubiquitously present in the cytoplasm of almost all cells. It is the convergence point of various signal transduction pathways and has the functions of regulating various immune responses, inflammatory responses, virus replication, cell apoptosis and proliferation and Function of growth and development-related gene expression. NF-κB is a dimeric protein composed of two Rel family proteins. According to the differences in structure, function and synthesis method, the Rel protein fami...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435
Inventor梁华平徐祥王正国
OwnerTHE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA