Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof
A nuclear factor and anti-nuclear factor technology, which can be applied in the fields of peptide sources, drug combinations, animal/human peptides, etc., can solve problems such as difficult to achieve, and achieve the effect of broad market prospects and wide application value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Fusion expression and purification of nuclear factor-κB p50 subunit binding peptide and GST
[0033] According to the gene sequence of the binding polypeptide, while keeping the coding sequence of the polypeptide protein gene unchanged, according to the codon preference of Escherichia coli, design and synthesize the complementary DNA fragments with the upstream gene sequence containing BamH I and the downstream gene sequence containing Sal I cohesive ends , the DNA sequence is as follows, and the DNA sequence was synthesized by Shanghai Biological Engineering Co., Ltd.
[0034] FP:
[0035] 5'-GATCAACACTTGGGGTATGCTGAGCCTGCGTATCATCGTTCGCCTGGTTCGTCGTAACTCCTACTACCGTCGTAACTCCTACTACGGCACCCAGGACAACAGCCACCTGGCACGCGTTCACTTCCTGCTG-3'
[0036] RP:
[0037] 5'-TCGACAGCAGGAAGTGAACGCGTGCCAGGTGGCTGTTGTCCTGGGTGCCGTAGTAGGAGTTACGACGGTAGTAGGAGTTACGACGAACCAGGCGAACGATGATACGCAGGCTCAGCATACCCCAAGTGTT-3'
[0038]Dissolve the above DNA sequence with sterile double-distilled wate...
Embodiment 2
[0039] Example 2, Biosensor (Biosensor) detects GST-binding peptide fusion protein and nuclear factor-κB p50 subunit combination of
[0040] Put the carboxymethyl dextran biosensor chip into the microfluidic chuck of the Iasys Plus system, rinse with 60 μl PBS / T (pH7.4PBS, 0.05% Tween 20) for 3 times, equilibrate for 10min, and collect after the baseline leveled off Baseline data for 5 minutes; mix EDC and NHS at a ratio of 1:1, take 40 μl of the mixed solution to wash the sample pool twice, then add 40 μl of the mixed solution to the sample pool, and keep it for 7 minutes to activate the surface of the sensor sheet; use 50 μl of PBS / T Rinse the sample pool 3 times to collect the baseline value for 1 min; wash the sample pool with 40 μl of 10 mM pH5.5 acetate buffer solution for 3 times, then add 40 μl of acetate buffer solution, and collect the baseline value for 1 min; then add 40 μl of acetate buffer solution to the sample pool The total amount of dilution is about 0.5 ...
Embodiment 3
[0043] Example 3, ELISA method to detect the specific binding of GST-binding peptide fusion protein and nuclear factor-κB p50 subunit
[0044] Wash the coated wells of the ELISA plate with deionized water several times, invert the plate, and tap the plate on a clean filter paper to remove the remaining water; dilute the p50 protein with PBS buffer solution at a concentration of 10 μg / ml; add 100 μl of the diluted p50 protein Put it into the coated wells of 96-well ELISA plate, incubate at room temperature for 3-4 hours or overnight at 4°C, pay attention to the evaporation of water; wash the wells with 300 μl PBS three times to remove unbound p50 protein; prepare 5% aqueous solution of skimmed milk powder , add 200μl to each well, incubate at room temperature for 1h or incubate overnight at 4°C to seal the coated well; use protein binding buffer (50mM Tris-HCl, pH7.2, 100mM NaCl, 10mM MgCl2, 10uM ZncL2, 1mM DTT, 0.1% (v / v) NP40) Wash the plate 5 times; add 0.5 μmol / L GST-bin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 