Expression vector for secreting expression of exogenous gene in Escherichia coli or bacillus and its construction
A Bacillus, secretory expression technology, applied in the field of genetic engineering, can solve problems such as difficulty in secretory expression of exogenous genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0098] The construction of embodiment 1 vector pBL-WZX
[0099] The construction process of the vector pBL-WZX is as follows: figure 1 shown. The primers used were chemically synthesized by a DNA synthesizer, and the sequences are as follows.
[0100] Primer P1: aat ggatcc attggtaactgtatctcagc
[0101] Primer P2: aac ggatcc gttcaattttgtgtttc
[0102] Primer P1-1: tatagggaaaatggtacttgttaaaaattc
[0103] Primer P2-1: aac agatct gttcaattttgtgtttc
[0104] Primer P3: aac agatct ctgcctcgcgcgtttcggtgat
[0105] Primer P4: tcg agatct cgaataataactgttatttttca
[0106] Primer P5: ttataagacg ggcaaaataa aaaaacggat ttccttcagg aaatccgtcctctctgctct atctaattag catgccatgg tacccgggag ctcgaattct agatttgccgccgctgctgc
[0107] Primer P6: tggtcttatgacttgggcgcgct
[0108] The underlined part is the artificially introduced restriction enzyme cutting site.
[0109] The construction process of vector pBL-WZX is as follows: using primers P1 and P2 to use Bacillus licheniformis ATCC14...
Embodiment 2
[0110] Example 2 Applicability evaluation of vector pBL-WZX in Escherichia coli
[0111] BLi-man1 is the upstream primer, its sequence is acg gaattc acaccgtttctccggtgaacc, BLi-man2 is the downstream primer, its sequence is cccgggcctcttatcggcggattggctt, using BLi-man1 and BLi-man2 as primers to amplify the structural gene sequence encoding the mature peptide of β-mannanase from the chromosomal DNA of Bacillus licheniformis ATCC14580 strain , PCR products were digested with EcoRI after purification. The expression vector pBL-WZX was linearized with EcoRI and SmaI at the same time. Under the action of T4 ligase, the two were ligated and transformed into Escherichia coli DE, and the recombinant expression plasmid pBL-man and recombinant strain DE(MAN) were obtained by screening on a plate containing ampicillin and kanamycin. The recombinant strain DE (MAN) was cultured in LB medium (0.5% yeast extract, 1% peptone, 1% sodium chloride; pH7.0) at 37°C and 220r / min for 24-72h. Wit...
Embodiment 3
[0112] Example 3 Applicability evaluation of vector pBL-WZX in Bacillus
[0113]Bacillus licheniformis CICIMB03036 was electrotransformed with the recombinant expression plasmid pBL-man obtained in Example 2, and the recombinant strain BL(MAN) was obtained on the LB plate containing kanamycin. Recombinant bacteria BL (MAN) were cultured in fermentation medium (lactose 100g / L, bean cake powder 50g / L, ammonium sulfate 1g / L; pH7.0) at 37°C and 220r / min for 168h, and the recombinant bacteria in the medium The accumulation of β-mannanase in the culture medium reached above 3.1 mg / mL.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 