Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression vector for secreting expression of exogenous gene in Escherichia coli or bacillus and its construction

A Bacillus, secretory expression technology, applied in the field of genetic engineering, can solve problems such as difficulty in secretory expression of exogenous genes

Active Publication Date: 2006-01-18
福建福大百特生物科技有限公司
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with protein secretion and expression in Bacillus, the secretion and expression of foreign genes in E. coli is more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector for secreting expression of exogenous gene in Escherichia coli or bacillus and its construction
  • Expression vector for secreting expression of exogenous gene in Escherichia coli or bacillus and its construction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] The construction of embodiment 1 vector pBL-WZX

[0099] The construction process of the vector pBL-WZX is as follows: figure 1 shown. The primers used were chemically synthesized by a DNA synthesizer, and the sequences are as follows.

[0100] Primer P1: aat ggatcc attggtaactgtatctcagc

[0101] Primer P2: aac ggatcc gttcaattttgtgtttc

[0102] Primer P1-1: tatagggaaaatggtacttgttaaaaattc

[0103] Primer P2-1: aac agatct gttcaattttgtgtttc

[0104] Primer P3: aac agatct ctgcctcgcgcgtttcggtgat

[0105] Primer P4: tcg agatct cgaataataactgttatttttca

[0106] Primer P5: ttataagacg ggcaaaataa aaaaacggat ttccttcagg aaatccgtcctctctgctct atctaattag catgccatgg tacccgggag ctcgaattct agatttgccgccgctgctgc

[0107] Primer P6: tggtcttatgacttgggcgcgct

[0108] The underlined part is the artificially introduced restriction enzyme cutting site.

[0109] The construction process of vector pBL-WZX is as follows: using primers P1 and P2 to use Bacillus licheniformis ATCC14...

Embodiment 2

[0110] Example 2 Applicability evaluation of vector pBL-WZX in Escherichia coli

[0111] BLi-man1 is the upstream primer, its sequence is acg gaattc acaccgtttctccggtgaacc, BLi-man2 is the downstream primer, its sequence is cccgggcctcttatcggcggattggctt, using BLi-man1 and BLi-man2 as primers to amplify the structural gene sequence encoding the mature peptide of β-mannanase from the chromosomal DNA of Bacillus licheniformis ATCC14580 strain , PCR products were digested with EcoRI after purification. The expression vector pBL-WZX was linearized with EcoRI and SmaI at the same time. Under the action of T4 ligase, the two were ligated and transformed into Escherichia coli DE, and the recombinant expression plasmid pBL-man and recombinant strain DE(MAN) were obtained by screening on a plate containing ampicillin and kanamycin. The recombinant strain DE (MAN) was cultured in LB medium (0.5% yeast extract, 1% peptone, 1% sodium chloride; pH7.0) at 37°C and 220r / min for 24-72h. Wit...

Embodiment 3

[0112] Example 3 Applicability evaluation of vector pBL-WZX in Bacillus

[0113]Bacillus licheniformis CICIMB03036 was electrotransformed with the recombinant expression plasmid pBL-man obtained in Example 2, and the recombinant strain BL(MAN) was obtained on the LB plate containing kanamycin. Recombinant bacteria BL (MAN) were cultured in fermentation medium (lactose 100g / L, bean cake powder 50g / L, ammonium sulfate 1g / L; pH7.0) at 37°C and 220r / min for 168h, and the recombinant bacteria in the medium The accumulation of β-mannanase in the culture medium reached above 3.1 mg / mL.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is expression vector to secretion express foreign gene in colibacillus or bacillus and its construction, and belongs to the field of gene engineering technology. The expression vector pBL-WZX contains one promoter sequence with function in both colibacillus and bacillus, one signal peptide sequence with function in both colibacillus and bacillus, one polyclonal site for foreign gene to be cloned, one artificially transcription termination sequence, one genetic marker for cloning selection between colibacillus and bacillus, and one DNA sequence for foreign gene to complete integration and gene copy number proliferation in the chromosome DNA of bacillus. The expression vector pBL-WZX can induce the transcription and translation of foreign gene and secrete the gene product to outside cell, and has foreign gene secretion expression interventing level up to 1 mg / mL in colibacillus and 3.1 mg / mL in bacillus separately.

Description

technical field [0001] The invention discloses an expression vector for secreting and expressing foreign genes in Escherichia coli or bacillus and its construction, relates to a method for constructing a gene expression vector, and belongs to the technical field of genetic engineering. technical background [0002] The E. coli expression system is a commonly used tool in genetic engineering. Although it cannot perform post-translational processing like the eukaryotic system, it is still one of the most widely used exogenous gene expression systems due to its clear genetic background, safe use, easy operation, and short cycle. [0003] A major advantage of Bacillus as a gene cloning and expression system is its ability to secrete proteins outside the cell. Therefore, the research on its carrier-receptor system has been paid more and more attention. Bacillus is the producer of some important industrial enzyme preparations. Since Spizizen et al. discovered in 1958 that the B...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/75
Inventor 王正祥牛丹丹
Owner 福建福大百特生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com