Medicine for promoting pigling growth and improving pigling immunity and preparing method thereof

An immunity and piglet technology, applied in the directions of pharmaceutical formula, drug combination, drug delivery, etc., can solve the problems of high cost and loss of pig industry, and achieve the effect of promoting growth and development, promoting the growth of piglets, and improving immune function.

Inactive Publication Date: 2007-03-14
张永亮
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above situation has caused huge losses to the pig industry
[0006] At present, the methods to overcome the above problems mainly include increasing the nutrient level of the feed, acidifying the diet, adding e

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine for promoting pigling growth and improving pigling immunity and preparing method thereof
  • Medicine for promoting pigling growth and improving pigling immunity and preparing method thereof
  • Medicine for promoting pigling growth and improving pigling immunity and preparing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Plasmid construction

[0045]The method of chemical synthesis is used to prepare the gene of porcine GHRH (1-32) with BamHI sites at both ends, digest with BamHI, and recover the GHRH fragment after electrophoresis. At the same time, the pCMV-Rep-LacZ vector was digested with BamH I, and the large fragment of the vector was recovered after electrophoresis. The recovered product was dephosphorylated with alkaline phosphatase, ligated with the target fragment with T4 ligase, and transformed into E. coli DH10B competent by electroporation. Bacteria, blue-white screening of recombinant plasmids, enzyme digestion and PCR identification (see attached picture) After the correctness, the identification of the direction of gene insertion is required. Two primers (P3: 5'-end vector primer; P4: 3'-end vector primer) were designed according to the sequence near the upstream and downstream of the lacZ gene on the vector, respectively: P3 GTGTCTTAAGACTAATATCGCG; P4 TTTGCCTTTTCTCTCACA...

Embodiment 2

[0047] Plasmid extraction

[0048] Pick a single colony from the freshly transformed plasmid JM109 plate and inoculate it into 50ml of LB liquid medium (containing Amp100μg / ml), shake it at 37°C until the OD260 is about 0.6, and inoculate 50ml of the culture into 2000ml of liquid LB medium (containing 100 μg / ml of Amp), continue shaking culture at 37° C. for about 20 hours. The above culture was centrifuged at 5000rpm for 10 minutes, the supernatant was discarded, the cell pellet was resuspended in 200ml ice-cold STE (0.1mmol / L NaCl, 10mmol / L Tris HCl pH8.0, 1mmol / L EDTA), Wash the cells, then centrifuge to collect the cells and store them in a -20°C refrigerator. Add 24ml of solution I (50mmol / L glucose, 25mmol / L Tris-HCl pH8.0, 10mmol / LEDTA, autoclaved for 15min) to the bacteria respectively, after fully suspending, add 1.2ml of 10mg / ml lysozyme, 30min at 4°C. Add 48ml of solution II (0.2mol / L NaOH, 1% SDS), cap the centrifuge tube tightly, slowly invert the centrifuge tu...

Embodiment 3

[0050] The microsphere preparation process is as follows:

[0051] (1) Take 500 μl of pCMV-Rep-GHRH plasmid solution, put it in a 25ml beaker, add 1.35ml of CH2Cl2, 0.15ml of acetone, 0.25g of PLGA, and fully dissolve it.

[0052] (2) The ultrasonic power is 15W, the ultrasonic interval is 3S for 3S, and the ultrasonic time is 40-70S to make the solution uniform.

[0053] (3) Add 8ml of 4% PVA to each beaker, and ultrasonicate for 60-120S. (Take 1 drop of the suspension and gently drop it into the aqueous solution to see if it can settle).

[0054] (4) Add 20 ml of 0.4% PVA to each beaker, and stir magnetically at room temperature for 8-10 hours.

[0055] (5) Use 4 layers of sterilized nylon cloth to filter the above solution into a 40ml sterile centrifuge tube (accurately weigh the weight of the centrifuge tube), and let the solution filter out as much as possible.

[0056] (6) Centrifuge the collected solution at 10000-12000 rpm for 10 min.

[0057] (7) Take the supernat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to view more

Abstract

The invention relates to a drug used to accelerate the growth of pigling and improve its immunity, and relative production. Wherein, it is formed by PLGA microball that packing anterior pituitary growth hormone release hormone expression particle pCMV-Rep-GHRH; via ejecting said PLGA microball particles pCMV-Rep-GHRH into female pig, to express GHRH and improve the GH level, it can accelerate the growth of pigling and improve its immunity.

Description

Technical field: [0001] The invention relates to a medicine for promoting piglet growth and improving piglet immunity and a preparation method, relates to a gene related to growth hormone regulation and its expression in animals, and belongs to the field of gene medicine for improving animal production performance and its application. Background technique: [0002] Growth hormone (GH for short) is the main hormone that regulates the growth of animals and humans. It has the functions of promoting growth, increasing lean meat percentage, inhibiting fat synthesis and improving immunity, and has important application value in animal husbandry. The level of GH is mainly regulated by the positive regulator growth hormone releasing hormone (growth hormone releasing hormone, GHRH for short) and the negative regulator, somatostatin (SS) or somatostatin for short. GHRH controls the pulsatile secretion of GH, SS controls the basal secretion, and SS has an antagonistic effect on GHRH, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K48/00A61K9/30A61P5/20A61P37/02
Inventor 张永亮刘松财任晓慧戴建威郝琳林
Owner 张永亮
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap