Medicine for promoting pigling growth and improving pigling immunity and preparing method thereof
An immunity and piglet technology, applied in the directions of pharmaceutical formula, drug combination, drug delivery, etc., can solve the problems of high cost and loss of pig industry, and achieve the effect of promoting growth and development, promoting the growth of piglets, and improving immune function.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Plasmid construction
[0045]The method of chemical synthesis is used to prepare the gene of porcine GHRH (1-32) with BamHI sites at both ends, digest with BamHI, and recover the GHRH fragment after electrophoresis. At the same time, the pCMV-Rep-LacZ vector was digested with BamH I, and the large fragment of the vector was recovered after electrophoresis. The recovered product was dephosphorylated with alkaline phosphatase, ligated with the target fragment with T4 ligase, and transformed into E. coli DH10B competent by electroporation. Bacteria, blue-white screening of recombinant plasmids, enzyme digestion and PCR identification (see attached picture) After the correctness, the identification of the direction of gene insertion is required. Two primers (P3: 5'-end vector primer; P4: 3'-end vector primer) were designed according to the sequence near the upstream and downstream of the lacZ gene on the vector, respectively: P3 GTGTCTTAAGACTAATATCGCG; P4 TTTGCCTTTTCTCTCACA...
Embodiment 2
[0047] Plasmid extraction
[0048] Pick a single colony from the freshly transformed plasmid JM109 plate and inoculate it into 50ml of LB liquid medium (containing Amp100μg / ml), shake it at 37°C until the OD260 is about 0.6, and inoculate 50ml of the culture into 2000ml of liquid LB medium (containing 100 μg / ml of Amp), continue shaking culture at 37° C. for about 20 hours. The above culture was centrifuged at 5000rpm for 10 minutes, the supernatant was discarded, the cell pellet was resuspended in 200ml ice-cold STE (0.1mmol / L NaCl, 10mmol / L Tris HCl pH8.0, 1mmol / L EDTA), Wash the cells, then centrifuge to collect the cells and store them in a -20°C refrigerator. Add 24ml of solution I (50mmol / L glucose, 25mmol / L Tris-HCl pH8.0, 10mmol / LEDTA, autoclaved for 15min) to the bacteria respectively, after fully suspending, add 1.2ml of 10mg / ml lysozyme, 30min at 4°C. Add 48ml of solution II (0.2mol / L NaOH, 1% SDS), cap the centrifuge tube tightly, slowly invert the centrifuge tu...
Embodiment 3
[0050] The microsphere preparation process is as follows:
[0051] (1) Take 500 μl of pCMV-Rep-GHRH plasmid solution, put it in a 25ml beaker, add 1.35ml of CH2Cl2, 0.15ml of acetone, 0.25g of PLGA, and fully dissolve it.
[0052] (2) The ultrasonic power is 15W, the ultrasonic interval is 3S for 3S, and the ultrasonic time is 40-70S to make the solution uniform.
[0053] (3) Add 8ml of 4% PVA to each beaker, and ultrasonicate for 60-120S. (Take 1 drop of the suspension and gently drop it into the aqueous solution to see if it can settle).
[0054] (4) Add 20 ml of 0.4% PVA to each beaker, and stir magnetically at room temperature for 8-10 hours.
[0055] (5) Use 4 layers of sterilized nylon cloth to filter the above solution into a 40ml sterile centrifuge tube (accurately weigh the weight of the centrifuge tube), and let the solution filter out as much as possible.
[0056] (6) Centrifuge the collected solution at 10000-12000 rpm for 10 min.
[0057] (7) Take the supernat...
PUM
Property | Measurement | Unit |
---|---|---|
Particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com