Cytoplasmic inhibition of gene expression

Inactive Publication Date: 2005-09-15
LARGE SCALE BIOLOGY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0013] Another aspect of the invention is to provide methods of reducing the expression of a gene of interest in eukaryotic cells, i.e., methods of producing eukaryotic cells exhibiting reduced levels of expression of a gene of interest. The methods of the invention comprise the step of transforming a cell with a genetic construction of the inv

Problems solved by technology

Furthermore, it was not known if adequate concentrations of inhibitory RNA could be provided in the cytoplasm.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cytoplasmic inhibition of gene expression
  • Cytoplasmic inhibition of gene expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation of Tomato Mosaic Virus cDNA

[0035] An 861 bp fragment (5524-6384) from the tomato mosaic virus (fruit necrosis strain F; ToMV-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3′ end was isolated by PCR using ToMV primers 5′ CTCGCAAAGTTTCGAACCAAATCCTC 3′ (SEQ ID NO: 1) (upstream) and 540 CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG3′ (SEQ ID NO: 2) (downstream) and subcloned into the HincII site of pBluescript KS-. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-bp XhoI-KpnI ToMV fragment into pBGC152 (Kumagai, et al., Proc. Natl. Acad. Sci. USA 90:427-430 (1993)), creating plasmid TTO1. The inserted fragment was verified by dideoxynucleotide sequencing. A unique AvrII site was inserted downstream of the XhoI site in TTO1 by PCR mutagenesis, creating plasmid TTO1A, using the following oligonucleotides:

(SEQ ID NO: 3)5′ TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA 3′(upstream),(SEQ ID NO: 2)5′ CGGGGTACCTGGGCCCCAAC...

example 2

Isolation of a cDNA Encoding Tomato Phytoene Synthase and a Partial cDNA Encoding Tomato Phytoene Desaturase

[0036] Partial cDNAs were isolated from ripening tomato fruit RNA by polymerase chain reaction (PCR) using the following oligonucleotides: PSY, 5′ TATGTATGGTGCAGAAGAACAGAT 3′ (SEQ ID NO:4) (upstream), 5′ AGTCGACTCTTCCTCTTCTGGCATC 3′ (SEQ ID NO: 5) (downstream); PDS, 5′ TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA 3′ (SEQ ID NO: 6) (upstream), 5′ AACTCGAGCGCTTTGATTTCTCCGAAGCTT 3′ (SEQ ID NO: 7) (downstream). Approximately 3×104 colonies from a Lycopersicon esculentum cDNA library were screened by colony hybridization using a 32 P labelled tomato phytoene synthase PCR product. Hybridization was carried out at 42° C. for 48 h in 50% formamide, 5×SSC, 0.02 M phosphate buffer, 5× Denhart's solution, and 0.1 mg / ml sheared calf thymus DNA. Filters were washed at 65° C. in 0.1×SSC, 0.1% SDS prior to autoradiography. PCR products and the phyoene synthase cDNA clones were verified by dideoxynucleoti...

example 3

DNA Sequencing and Computer Analysis

[0037] A 1.2 Kb PstI, BamHI fragment containing the phytoene synthase cDNA and a 0.7 Kb the partial phytoene desaturase cDNA was subcloned into pBluescript KS+ (Stratagene, La Jolla, Calif.). The nucleotide sequencing of KS+ / PDS #38 and KS+ / 5′3′PSY was carried out by dideoxy termination using single stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using PCGENE and DNA Inspector IIE programs.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Gene expression profileaaaaaaaaaa
Inhibitionaaaaaaaaaa
Login to View More

Abstract

The invention provides novel genetic constructions for the expression of inhibitory RNA in the cytoplasm of eukaryotic cells. The inhibitory RNA may be an anti-sense RNA or a co-suppressor RNA, and functions to reduce the expression of a gene of interest in the target cell. The genetic constructions of the invention are capable of replicating in the cytoplasm of a eukaryotic cell and comprise a promoter region in functional combination with an encoding polynucleotide. The genetic constructions may be designed so as to replicate in the cytoplasm of plant cells, yeast cells, and mammalian cells. When the eukaryotic cell of interest is a plant cell, the genetic construction is preferably derived from a plant RNA virus. Plant RNA virus derived genetic constructions may employ a plant virus subgenomic promoter, including subgenomic promoters from tobamoviruses in functional combination with the RNA encoding region. In a preferred embodiment of the invention, plant cells are induced to produce elevated levels of the carotenoid phytoene. The elevated levels of phytoene are achieved by inhibiting the expression of the enzyme phytoene desaturase using the vectors of the invention.

Description

[0001] This application is a continuation of U.S. application Ser. No. 09 / 265,576, filed Mar. 9, 1999; which is a continuation of U.S. application Ser. No. 08 / 260,546, filed Jun. 16, 1994, now U.S. Pat. No. 5,922,602.FIELD OF THE INVENTION [0002] This invention is in the field of gene regulation through anti-sense RNA endogenously produced inhibitory RNA molecules such as anti-sense RNA and co-suppressor RNA. BACKGROUND [0003] One of the primary goals of genetic engineering has been to control the expression of selected genes in eukaryotic organisms of interest. While it has been relatively straightforward to insert new genes for expression into eukaryotic cells, the targeting of endogenous genes for reduced expression has been more difficult to achieve. Site-directed inactivation of genes in higher organisms has required extremely complex genetic manipulations and is not applicable to a wide range of organisms. One method of reducing the expression of specific genes in eukaryotic o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/08C07K14/095C07K14/415A01H5/00C07K14/705C12N1/19C12N5/10C12N9/00C12N9/02C12N9/10C12N9/14C12N9/16C12N9/18C12N9/20C12N9/24C12N9/72C12N9/78C12N9/84C12N15/09C12N15/113C12N15/12C12N15/40C12N15/53C12N15/82C12N15/83C12N15/86C12P21/04C12P41/00
CPCC07K14/005C12N9/1085C07K14/70571C12N9/00C12N9/0059C12N9/0071C12N9/0083C12N9/1074C12N9/14C12N9/16C12N9/18C12N9/20C12N9/6459C12N9/78C12N9/84C12N15/1137C12N15/8203C12N15/8216C12N15/8218C12N15/8249C12N15/825C12N15/8289C12N15/86C12N2710/22043C12N2710/22062C12N2750/12043C12N2770/00022C12N2770/00043C12N2770/00051C12N2770/32643C12N2770/32662C12N2770/32722C12N2770/32743C12N2770/32762C12N2770/36143C12N2770/36162C12N2799/021C12N2810/609C12P41/003C12Y114/18001C12Y302/01031G01N2333/4353C12Y304/21069C07K14/415
InventorKUMAGAI, MONTODELLA-CIOPPA, GUYDONSON, JONATHANHARVEY, DAMONGRILL, LAURENCE
OwnerLARGE SCALE BIOLOGY