TC-83-derived alphavirus vectors, particles and methods

a technology of alphavirus and vector, applied in the field of recombinant dna technology, can solve the problem of not being able to predict whether it can serve as an effective genetic background for the replicon particle system, and achieve the effect of reducing protein expression, maximizing expression, and reducing such expression

Inactive Publication Date: 2005-12-01
ALPHAVAX INC
View PDF60 Cites 53 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0009] The present invention provides compositions of infective, replication-defective, highly immunogenic alphavirus replicon particles based on a particular alphavirus strain, i.e., the TC-83 of VEE, and methods of preparation thereof. As described previously (see, for example, U.S. Pat. Nos. 5,792,462; 6,156,558; 5,811,407; 6,008,035; 6,583,121; WO 03 / 023026; U.S. Publication No. 2003 / 0119182, all incorporated herein by reference), functional alphavirus replicon particles have been made from several different alphaviruses and chimeras thereof (see, for example, U.S. Publication No 2003 / 0148262). These particles are useful in vaccine and gene therapy applications, and the optimal characteristics of the alphavirus replicon particles differ in these applications. For instance, it may be useful to reduce the expression of proteins from the replicon during gene therapy applications, and thus techniques have been developed in the art to reduce such expression (see e.g. U.S. Pat. Nos. 5,843,723 and 6,451,592). In the case of vaccine applications, maximizing the expression of the heterologous RNA from the replicon, minimizing any anti-vector responses, and targeting the tissues and cells of the immune system are desirable features. The alphaviruses Venezuelan Equine Encephalitis (VEE) virus and South African Arbovirus No. 86 have proved particularly useful in the vaccine applications. To improve the safety of these alphavirus vectors in the rare event that a replication-competent virus is generated, at least one attenuating mutation has been introduced into the alphaviral genomic fragments. The present inventors have now discovered that the TC-83 strain of VEE can be used as the genetic background for an alphavirus replicon particle system which provides a surprisingly effective VEE particle preparation for use in immunogenic compositions and which has other surprisingly advantageous properties useful in a vaccine vector system, including the ability to prepare purified preparations with ease.
[0011] The inventors have now produced a replicon particle vaccine based on the TC-83 strain, and it has several surprisingly advantageous characteristics for both vaccine and gene therapy applications including, but not limited to, much higher yields as compared to those achieved with particles based on wild-type VEE or on those carrying other attenuating mutations; lowered anti-vector responses; increased purity; excellent immunogenicity that is comparable to other VEE strains carrying only one, two or three attenuating mutations, and no non-responsiveness, in contrast to the noted non-responsiveness of animals to the live TC-83 strain used as a vaccine.
[0012] Additionally, the inventors have discovered that packaging an alphavirus replicon in the VEETC83 structural proteins results in significantly higher yields of replicon particle vaccines from cell cultures. Thus, the VEETC83 structural proteins can be advantageously used to package replicons from other alphaviruses, including other strains of VEE.

Problems solved by technology

However, the methods used do not exclude contributions from other mutations, and the existence of the numerous other nonconservative mutations in the TC-83 genome make it impossible to predict whether it can serve as an effective genetic background for the replicon particle system.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TC-83-derived alphavirus vectors, particles and methods
  • TC-83-derived alphavirus vectors, particles and methods
  • TC-83-derived alphavirus vectors, particles and methods

Examples

Experimental program
Comparison scheme
Effect test

example 1

Production of TC-83 Replicons

[0084] A replicon plasmid based on the TC-83 strain of VEE was produced from a TC-83 infectious cDNA clone, pVE / IC-92, obtained from the Centers for Disease Control and Prevention. The sequence of this clone was published by Kinney et al. (1993) J. Virol. 67:1269. The pVE / IC-92 sequence differs from the TC-83 virus genomic sequence by the presence of an Ala-Val mutation at E1-119 (a cloning artifact introduced by Kinney) and three silent mutations in nsp1 (at 1613A→G; at 1616C→A; at 1619T→C) purposely introduced to distinguish the clone-derived virus from the genomic sequence. The present inventors have identified an additional silent mutation at E1 position in the pVE / IC-92 clone. By “silent” is meant that the change in the nucleic acid sequence does not cause a change in the amino acid that is encoded by that nucleic acid sequence.

[0085] The TC-83 replicon vector (“pVEK”) was produced by first transferring an expressible sequence encoding kanamycin r...

example 2

Production of TC-83 Helpers

A. DNA Helper

[0090] A TC-83 DNA helper was constructed from pCDNA-VSp, which is described in U.S. Patent Publication No. 2003-0119182, Example 5. pCDNA-VSp is a DNA helper in which the VEE3014 VEE structural proteins are expressed directly from a CMV promoter. The glycoprotein gene sequence containing the TC-83 mutations was digested from pVE / IC-92 using SpeI and ScaI restriction enzymes, and ligated into pCDNA-Vsp which has been digested with the same enzymes. The introduced mutation at E1-119, which was noted but uncorrected by Kinney et al. (1993) J. Virol. supra as an artifact of the cDNA cloning to produce VE / IC-92, was repaired using the quick change site-directed mutagenesis kit (Stratagene, LaJolla, Calif.) and primers TC83E1119F (GCCTTGCGGATCATGCTGMGCATATAAAGCGC) (SEQ ID NO:2) and TC83E1119R (GCGCTTTATATGCTTCAGCATGATCCGCAAGGC) (SEQ ID NO:3) to generate pCDNA-TC83r.

[0091]E. coli cultures transformed with the DNA helper plasmids were sent to Pur...

example 3

Packaging of TC-83 Replicon with Various Helpers

[0094] VEETC83 replicon particles (VRPs) were produced by co-electroporation of a TC83 replicon RNA (expressing the HIV GAG gene), and one or more helper nucleic acids (see Table 1) into Vero cells. Following electroporation, the cells were seeded into 2 T300 flasks containing OptiPRO® (Gibco, Carlsbad, Calif.) and incubated for approximately 18 hours. The media was removed from each flask, and 10 ml of a 0.5 M salt wash solution in 10 mM sodium phosphate buffer was added to each flask and incubated for approximately 5 minutes at room temperature before collection and filtration. VRP were titered by incubating serial dilutions of the salt wash and / or the collected medium on Vero cells in 96 well plates overnight at 37° C. and 5% CO2. GAG VRP infected cells were detected using an anti-GAG indirect immunofluorescence assay on Vero cells fixed with MeOH, and titers were determined by counting GAG positive cells at a specific dilution. Si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
ionic strengthaaaaaaaaaa
ionic strengthaaaaaaaaaa
ionic strengthaaaaaaaaaa
Login to View More

Abstract

The present disclosure provides TC-83 VEE-derived replicons, alphaviral replicon particles and immunogenic compositions containing TC-83 alphaviral replicon particles which direct the expression of at least one antigen when introduced into a suitable host cell. The TC-83 VEE-derived ARPs described herein are improved in that they are subject to a lower vector-specific immune response than prior art ARPs.

Description

CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims benefit of U.S. Provisional Application No. 60 / 572,212, filed May 18, 2004, which application is incorporated by reference herein to the extent there is no inconsistency with the present disclosure.ACKNOWLEDGMENT OF FEDERAL RESEARCH SUPPORT [0002] This invention was made, at least in part, through funding from the United States government, through grants from the National Institutes of Health, grant numbers 1U01 AI056438-01 and 5U01 AI 55071-02.BACKGROUND OF THE INVENTION [0003] The present invention relates to recombinant DNA technology, and in particular to introducing foreign nucleic acid in a eukaryotic cell, and more particularly to compositions and methods for producing alphavirus replicon particles useful in immunotherapies and / or gene therapy applications. In particular, the present invention discloses a genetic background for the alphavirus replicon particle system that is based on the Venezuelan Equine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K39/12A61K39/21A61K48/00C07K14/16C07K14/18C12N5/10C12N7/04C12N15/00C12N15/09C12N15/63C12N15/70C12N15/74C12N15/86C12P21/06
CPCA61K39/21A61K48/00A61K2039/5256A61K2039/5258C07K14/005C12N2840/203C12N15/86C12N2740/16222C12N2740/16234C12N2770/36143C12N2770/36162C12N7/00A61K39/12A61P31/14A61P35/00A61P37/04A61K39/0011C12N2770/36152A61K2039/575C12N2770/36123C12N2770/36134
InventorRAYNER, JONSMITH, JONATHANHUBBY, BOLYNREAP, ELIZABETH
OwnerALPHAVAX INC