Cochleate compositions directed against expression of proteins

a technology of cochleate composition and protein, applied in the direction of oxidoreductase, peptide/protein ingredients, dna/rna fragmentation, etc., can solve the problems of cytotoxicity, poor cell penetration, and limited use of antisense currently available,

Inactive Publication Date: 2008-01-10
BIODELIVERY SCI +1
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

Cochleate delivery vehicles improve the bioavailability and therapeutic effectiveness of siRNA and morpholinos by ensuring their safe and effective delivery into cells, leading to significant reduction in target mRNA expression and protein synthesis, thereby treating a wide range of diseases.

Problems solved by technology

An obstacle to the realization of the full potential of gene therapy is the development of safe and effective means for delivering siRNA to cells and organisms.
While the potential of antisense is widely recognized, there are numerous limitations to the use of antisense currently available.
One of the key limiting aspects of this strategy is poor cell penetration.
However, the penetration of the endosomal barrier is a pre-requisite event for antisense activity and the naked antisense oligonucleotides do not appear to do this in great extent.
Although complexes of antisense oligonucleotides with cationic liposomes, in some instances, have enhanced intracellular delivery, they have come with a disadvantage, cytotoxicity.
Their utility in vitro and in vivo has also been limited by their lack of stability in serum and their inflammatory properties.
Scraping the cells causes damage to the membrane, thereby reducing the viability of the cell population and ultimately altering the cellular characteristics of the remaining viable cells.
The second method, the “special delivery vehicle” supplied with the morpholino, requires dramatic changes in pH that result in very low efficacy.
The low efficacy of the “special delivery vehicle” may be due to cytotoxicity or other changes to the cells.
The above methods are not translatable to in vivo delivery because they involve compromise of the target cells and pH changes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cochleate compositions directed against expression of proteins
  • Cochleate compositions directed against expression of proteins
  • Cochleate compositions directed against expression of proteins

Examples

Experimental program
Comparison scheme
Effect test

example 1

Preparation of Morpholino Cochleates

[0278] Rhodamine-labeled phosphatidyl ethanolamine (Rho-PE) liposomes were prepared by adding dioleoylphosphatidylserine (DOPS) and Rho-PE at a ratio of 20:1 (Rho-PE:DOPS) to chloroform at a ratio of 10 mg lipid / ml in a 50 ml sterile tube. The concentration of Rho-PE was approximately 0.1% or 0.01% with respect to the DOPS.

[0279] The sample was blown down under nitrogen to form a film. Once dry, the sample was resuspended with TES buffer at a ratio of 10 mg lipid / ml. The liposomes were then passed through a 0.22 μm filter. The homogenous population of rhodamine-labeled liposomes were stored at 4° C. in the absence of light under nitrogen.

[0280] Morpholinos were obtained from GeneTools, LLC (Philomath, Oreg.) for the GAPDH antisense sequence 5′ATCCGTTGACACCGACCTTCACCAT3′ (SEQ ID NO.: 1), and GAPDH mismatch sequence 5′ATCCCTTGAGACCGAGCTTCTCCAT3′ (SEQ ID NO.: 2). These sequences have been used previously to target the first 25 bases of the coding ...

example 2

Delivery of Morpholinos Via Cochleates into Cells

[0284] Morpholino-cochleates were prepared as described in Example 1, with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to NGF differentiated rat P12 cells and photographed at 3 hours and 12 hours as shown in FIGS. 1A and 1B, respectively, after cochleate introduction. As illuminated by the fluoresced rhodamine using LCSM fluorescence imaging, the cochleates fuse with the outer membrane and form submembrane aggregates. FIGS. 1C (low power) and 1D (high power) are photographs of flouresced rhodamine labeled cochleates containing fluorescein isothiocyanate (FITC) labeled morpholinos. FIGS. 1C and 1D depict cochleates containing morpholinos, morpholinos that have been released into the cytosol from unwrapped cochleates, and the delivery of FITC labeled anti-GAPDH Morpholino into the cytoplasm. The morpholinos delivered into the cells depicted in these FIGS. 1A-D were retained in the cells for at least 72...

example 3

Delivery of Morpholinos Via Cochleates Into Retinal Ganglion Cells

[0287] Morpholino-cochleates were prepared as described in Example 1 with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to retinal ganglion cells in situ in retinal organotype culture. It was observed that the morpholino-cochleates readily interacted with the cells in the retinal ganglion cell layer (FIGS. 2A and 2B). FIGS. 2A and 2B are images of X-Y RGCL LCSM computational slices demonstrating avid cochleate uptake by retinal ganglion cells in situ. Scale bars indicate 10 micrometers.

[0288]FIG. 2A indicates cochleate delivery and biological activity of the antisense molecules. Interference with GAPDH by the antisense molecule triggers apoptosis, detected here by YOYO staining of all the retinal ganglion cells in the field. Cell nuclei with apoptotic chromatin condensation have very bright homogeneous YOYO signals (See FIG. 2B). This system provides a very efficient technique for del...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationsaaaaaaaaaa
concentrationsaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

Disclosed herein are novel siRNA-cochleate and morpholino-cochleate compositions. Also disclosed are methods of making and using siRNA-cochleate and morpholino-cochleate compositions.

Description

RELATED APPLICATIONS [0001] This application is a continuation of U.S. Ser. No. 10 / 822,235 filed Apr. 9, 2004, which_claims the benefit of U.S. Provisional Application No. 60 / 461,483, filed Apr. 9, 2003; U.S. Provisional Application Ser. No. 60 / 463,076, filed Apr. 15, 2003; U.S. Provisional Application Ser. No. 60 / 502,557, filed Sep. 11, 2003; U.S. Provisional Application No. 60 / 499,247 filed Aug. 28, 2003; U.S. Provisional Application No. 60 / 532,755, filed Dec. 24, 2003. The entire contents of each of the aforementioned applications are hereby expressly incorporated herein by reference in their entireties.BACKGROUND OF THE INVENTION [0002] In diverse eukaryotes, double-stranded RNA (dsRNA) triggers the destruction of mRNA sharing sequence with the double-strand (Hutvdgner et al. (2002) Curr. Opin. Genet. Dev. 12:225-232; Hannon (2002) Nature 418:244-251). In animals and basal eukaryotes, this process is called RNA interference (RNAi) (Fire et al. (1998) Nature 391:806-811). There i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K31/7052A61P17/00A61P19/00A61P25/00A61P3/00A61P31/00A61P35/00A61P37/00A61P7/00A61P9/00C12N5/00A61K9/00A61K9/127A61K31/7048A61K38/00A61K47/48C12N15/11C12N15/113
CPCC12N2310/14C12N2310/3233C12N2310/53C12N2320/32C12Y102/01012A61K9/1274A61K9/127A61K38/00C12N15/111C12N15/113C12N15/1135C12N15/1137A61K31/7048A61K31/7088C07H21/02C07H21/04A61K47/6919A61P1/04A61P1/16A61P1/18A61P11/00A61P11/02A61P11/06A61P13/08A61P13/12A61P15/00A61P15/08A61P17/00A61P17/06A61P19/00A61P19/02A61P21/00A61P21/04A61P25/00A61P25/02A61P25/16A61P25/18A61P25/24A61P25/28A61P27/02A61P29/00A61P3/00A61P3/04A61P31/00A61P31/04A61P31/10A61P31/12A61P35/00A61P35/02A61P3/06A61P37/00A61P37/02A61P37/06A61P43/00A61P7/00A61P7/02A61P7/04A61P7/06A61P9/00A61P9/10A61P3/10
InventorGOULD-FOGERITE, SUSANMANNINO, RAPHAEL J.AHL, PATRICKSHANG, GAOFENGCHEN, ZI WEIKRAUSE-ELSMORE, SARA L.
OwnerBIODELIVERY SCI