Methods for amplifying polymeric nucleic acids

a polymer nucleic acid and amplifying technology, applied in the field of nucleic acid replication and amplification, can solve the problems of increasing the technical difficulty of carrying out pcr, increasing the difficulty of pcr, and pcr process is quite susceptible to contamination, so as to achieve efficient extension products

Inactive Publication Date: 2008-02-14
INTEGRATED DNA TECHNOLOGIES
View PDF16 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a method for amplifying nucleic acid polymers in high complexity samples. The method involves using a unique primer set consisting of a mixture of two types of primers. One primer is non-replicable and cannot be copied by DNA polymerases, while the other primer is replicable and can be copied. The non-replicable primer hybridizes to the nucleic acid polymer and prevents it from being copied, while the replicable primer can be copied and extended throughout the polymer. The method can efficiently generate extension products that cannot be efficiently amplified in subsequent reactions with the same primer set. The resulting extension products have a sterilization number of about 10 or more, or preferably about 10,000 or more. The method can be carried out using genomic DNA as the nucleic acid polymer. The non-replicable primer has at least six 2′-O-alkyl riboses, and the replicable primer is labeled for detection. The concentration of each primer is about 0.6 μM to about 5 μM. Magnesium is present in the amplification reaction in a concentration of about 3 mM to about 6 mM.

Problems solved by technology

The PCR process is quite susceptible to contamination that is caused by the inadvertent transfer of DNA from one amplification reaction mixture into a subsequent reaction mixture.
Even the carryover of one full-length nucleic acid polymer that spans both PCR primer binding sites can be enough to cause a false-positive result in a subsequent reaction.
The presently known procedures for avoiding carryover contamination increase the technical difficulty of carrying out a PCR assay and add significantly to an assay's cost.
Primers that have an internal blocking group, such as 1,3-propanediol, can support primer extension and can give rise to amplicons but in subsequent rounds of replication those amplicons give rise to amplicons that terminate in the vicinity of the blocking group and therefore contain only a portion of the primer binding site which is not sufficient for primer binding.
Clearly, this is not a practical solution to the carryover contamination problem because designing and synthesizing such a large number of primers is time consuming and expensive and in most cases it simply isn't possible because there are not a sufficient number of primer-binding sites available and the use of such a large number of primers can poison amplification reactions.
None of these methods is totally effective and they involve additional processing steps that complicate the amplification method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0060] This and the following examples demonstrate the use of the polynomial amplification system for amplification of a human genetic locus, the NOD2 gene (SEQ ID NO: 48), from human genomic DNA.

[0061] Amplification primers were chosen to have similar melting temperatures, minimal secondary structure, minimal propensity to form heterodimers, and minimal risk of cross-hybridization as determined by a GenBank Blast search. The sequence of the genetic locus and primer binding sites is shown below in Table 1. The emboldened sequence represents the primer binding sites and the corresponding arrows represent the direction in which the primers are extended. Thus, the “For” primers extend to the right in the sequence. The primers designated “Rev” extend to the left and have sequences that are complementary to the sequence shown.

TABLE 1Oligonucleotide Primer Binding Sites For the NOD2 Locus                             For-0000        cccaatgagctcatcaacaaaggctcagtaccatcagtgaaatgtaaccgtc  ...

example 2

[0079] This example demonstrates the optimization of polynomial amplification reaction.

[0080] Polynomial amplification reaction mixtures had the following compositions:

Polyamp Reaction Mixture

[0081] Ingredients [0082] 10 mM Tris.Cl, pH 8.3 [0083] 50 mM KCl [0084] 5 mM MgCl2 [0085] 1×106 copies Rat CP gene target DNA [0086] 200 μM dNTPs (50 μM each) [0087] 200 nM (10 pmoles) forward (modified) primer oligonucleotide [0088] 200 nM (10 pmoles) second (nested) forward primer oligonucleotide (optional) [0089] 200 nM (10 pmoles) reverse primer oligonucleotide [0090] 2.5 units Amplitaq Gold® DNA polymerase (Applied Biosystems Inc., Foster City, Calif.) [0091] 50 μl final volume

[0092] Reactions were conducted in a PTC-200 Peltier Thermal Cycler (MJ Research, Waltham, Mass.). Cycling conditions were: 95° C. for 15 min followed by 10, 20, 30, 40, or 50 cycles of a 3-step cycle with 95° C. for 15 sec, 50° C. for 30 sec, and 72° C. for 30 sec, followed by incubation at 72° C. for 3 min. Af...

example 3

[0102] This example evaluates the annealing temperature of the polynomial amplification reaction method with various modified oligonucleotide primers.

[0103] Polynomial amplification reactions were carried out as described in Example 2 using 5 mM MgCl2 and varying the annealing temperatures in the temperature cycling method. Annealing temperatures of 50° C., 54° C., and 58° C. were compared. The following oligonucleotide primers (shown in Table 10) were investigated:

TABLE 10Oligonucleotide Primer SequencesACGACTCACTATAGACATGGTCAACSEQ ID NO: 121xNI:ACGACTCACTATAGACATyGTCAACSEQ ID NO: 132xNI:ACGACTCACTATAGACAyyGTCAACSEQ ID NO: 141xC3:ACGACTCACTATAGACATxGTCAACSEQ ID NO: 152xC3:ACGACTCACTATAGACAxxGTCAACSEQ ID NO: 161x-dS:CCACCGTGTTCTTdGACATCSEQ ID NO: 362x-dS:CCACCGTGTTCTddGACATCSEQ ID NO: 372′-O-methylGGATCCTCTAgaugcaTGCTCGSEQ ID NO: 38GATCCACGTTATGTCGGAGTGSEQ ID NO: 27

[0104] Unmodified primers in amplification reactions were found to be optimal from both quantitative (Taqman) and pu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperaturesaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The invention provides compositions and methods for amplifying nucleic acid polymer sequences in a high complexity nucleic acid sample. The unique compositions of the invention include a primer set composed of a mixture of two types of primers for DNA synthesis. For extension in one direction, the primers all contain modifications that destroy their ability to serve as templates that can be copied by DNA polymerases. For extension in the opposite direction the set includes at least one primer that can serve as a template and be replicated by DNA polymerases throughout its length. The method can be carried out by mixing the nucleic acid polymer sequence of interest with the set of DNA synthesis primers in an amplification reaction mixture. The reaction mixture is then subjected to temperature cycling analogous to the temperature cycling in PCR reactions. At least one primer in the primer set hybridizes to the nucleic acid polymer. It is preferred that the non-replicable primer hybridizes to the nucleic acid polymer and is extended to produce an extension product that contains sequence from the nucleic acid polymer to which the replicable primer then hybridizes. Of course, if the nucleic acid polymer is double stranded, both the replicable and nonreplicable primers will hybridize and be extended by DNA polymerase.

Description

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. provisional patent application No. 60 / 492,120, filed Aug. 1, 2003, which is incorporated herein by reference in its entirety.FIELD OF THE INVENTION [0002] The present invention relates to the field of nucleic acid replication and amplification. More specifically, the invention pertains to methods and compositions for amplifying nucleic acids using a thermostable DNA polymerase and a primer set that includes replicable and non-replicable primers. BACKGROUND OF THE INVENTION [0003] The polymerase chain reaction (PCR) method is commonly used to amplify specific nucleic acid polymer sequences. The procedure involves several sequential steps, including denaturation of DNA into single strands, annealing of oligonucleotide primers to a template DNA sequence, and extension of the primers with a DNA polymerase (Mullis, K. B. et al., U.S. Pat. Nos. 4,683,202, 4,683,195; Mullis, K. B., EP 201,184; Erlich, H., EP50,424, EP...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68C12P19/34
CPCC12Q1/6848C12Q1/6853C12Q1/686C12Q2527/143C12Q2525/101C12Q2549/119C12Q2525/186
InventorBEHLKE, MARK A.WALDER, JOSEPH A.MANTHEY, JEFFREY A.
OwnerINTEGRATED DNA TECHNOLOGIES