Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aromatic methyltransferases and uses thereof

a technology of methyltransferases and methyltransferases, which is applied in the direction of transferases, enzymology, gymnosperms, etc., can solve the problems of relatively high supplementation costs and difficult to achieve the recommended daily intake of 15-30 mg of vitamin e from the average american diet, so as to and increase the -tocopherol level

Inactive Publication Date: 2008-04-03
NORRIS SUSAN R +4
View PDF26 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The recommended daily dietary intake of 15-30 mg of vitamin E is quite difficult to achieve from the average American diet.
Furthermore, supplements tend to be relatively expensive, and the general population is disinclined to take vitamin supplements on a regular basis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aromatic methyltransferases and uses thereof
  • Aromatic methyltransferases and uses thereof
  • Aromatic methyltransferases and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Identification and Characterization of Mutant hdt2 Arabidopsis thaliana, Ecotype Landsberg Plants

[0378] Mutagenized (M2) seeds of Arabidopsis thaliana, ecotype Landsberg are obtained both by purchase from Lehle Seeds (Round Rock, Tex., U.S.A.) and by standard EMS mutagenesis methodology. The M2 plants are grown from the M2 seeds in greenhouse conditions with one plant per 2.5 inch pot. The resulting M3 seeds are collected from individual M2 plants and analyzed for tocopherol levels.

[0379] Seeds from approximately 10,000 M3 lines of Arabidopsis thaliana, ecotype Landsberg or Col-O are analyzed for individual tocopherol levels using the following procedure. Five milligrams of seeds from individual plants are ground to a fine powder using a ⅛″ steel ball bearing and vigorous shaking. 200 Microliters of 99.5% ethanol / 0.5% pyrogallol is added, mixed for 30 seconds and allowed to incubate at 4° C. for 1 h. 50 Microgram / ml of tocol (Matreya, Inc., Pleasant Gap, Pa.) is added to each samp...

example 2

Identification and Sequencing of the Mutant hdt2 Gene in the Arabidopsis thaliana, Landsberg Erecta (Ler) High δ-Tocopherol Mutants

[0381] Using map-based cloning techniques (see, for example, U.S. Ser. No. 09 / 803,736, Plant Polymorphic Markers and Uses Thereof, filed Mar. 12, 2001) the mutant hdt2 gene is mapped to chromosome 3 telomeric marker T12C14—1563 at 85 cM. This region contains approximately 60 predicted genes. Our analysis of the genes in this region revealed that one of the genes, MAA21—40, possesses homology to known ubiquinone methyltransferases. Based on this homology and the prediction that MAA21—40 is targeted to the chloroplast, this gene is determined to be likely to contain the mutation responsible for the high δ-tocopherol phenotype in hdt2 mutants. The sequences of the MAA21—40 gene locus in the wild types and hdt2 mutants are PCR amplified, and determined by standard sequencing methodology. The gene locus, in each case, is amplified using the sequencing primer...

example 3

Identification of Genes from Various Sources Demonstrating Homology to the tMT2 Gene from Arabidopsis thaliana

[0398] The protein sequence of tMT2 from Arabidopsis thaliana (NCBI General Identifier Number gi7573324) is used to search databases for plant sequences with homology to tMT2 using TBLASTN (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997); see also www.ncbi.nlm.nih.gov / BLAST / ). Nucleic acid sequences SEQ ID NO: 8 through 15 are found to have high homology with the Arabidopsis sequence.

>CPR19219 Brassica napus tMT2 homolog 1 - LIB4153-013-R1-K1-B7(SEQ ID NO: 13)ATGGCTTCTCTCATGCTCAACGGGGCCATCACCTTCCCCAAGGGATTAGGCTTCCCCGCTTCCAATCTACACGCCAGACCAAGTCCTCCGCTGAGTCTCGTCTCAAACACAGCCACGCGGAGACTCTCCGTGGCGACAAGATGCAGCAGCAGCAGCAGCGTGTCGGCGTCAAGGCCATCTGCGCAGCCTAGGTTCATCCAGCACAAGAAAGAGGCCTACTGGTTCTACAGGTTCCTGTCCATCGTGTACGACCACATCATCAATCCCGGCCACTGGACGGAGGATATGAGGGACGACGCTCTCGAGCCTGCGGATCTGAGCCATCCGGACATGCGAGTTGTCGACGTCGGAGGCGGAACGGGTTTCACCACGCTGGGAATCGTCAAGACGGTGAAGGCTAAGAACGTGACGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The present invention relates to genes associated with the tocopherol biosynthesis pathway. More particularly, the present invention provides and includes nucleic acid molecules, proteins, and antibodies associated with genes that encode polypeptides that have methyltransferase activity. The present invention also provides methods for utilizing such agents, for example in gene isolation, gene analysis and the production of transgenic plants. Moreover, the present invention includes transgenic plants modified to express the aforementioned polypeptides. In addition, the present invention includes methods for the production of products from the tocopherol biosynthesis pathway.

Description

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 60 / 330,563, filed Oct. 25, 2001, which is herein incorporated by reference in its entirety.[0002] The present invention is in the field of plant genetics and biochemistry. More specifically, the invention relates to genes associated with the tocopherol biosynthesis pathway, namely those encoding methyltransferase activity, and uses of such genes. [0003] Tocopherols are an important component of mammalian diets. Epidemiological evidence indicates that tocopherol supplementation can result in decreased risk for cardiovascular disease and cancer, can aid in immune function, and is associated with prevention or retardation of a number of degenerative disease processes in humans (Traber and Sies, Annu. Rev. Nutr. 16:321-347 (1996)). Tocopherol functions, in part, by stabilizing the lipid bilayer of biological membranes (Skrypin and Kagan, Biochim. Biophys. Acta 815:209 (1995); Kagan, N.Y. Acad....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A01H5/00C12N9/10C12N15/29C12N15/82
CPCC12N15/8243C12N9/1007
Inventor NORRIS, SUSAN R.LINCOLN, KIMSTEIN, JOSHUA C.VALENTIN, HENRY E.EENENNAAM, ALISON VAN
Owner NORRIS SUSAN R
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com