Methods for Improving Protein Properties

a technology of protein properties and methods, applied in the field of protein engineering, can solve problems such as inapplicability of conclusions, and achieve the effects of optimizing catalytic activity and/or stability, improving performance and/or stability, and optimizing storage stability

Inactive Publication Date: 2010-09-16
DANISCO US INC
View PDF13 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides methods for engineering proteins, particularly enzymes, to optimize their performance under specific environmental conditions. This includes optimizing catalytic activity, stability, and storage stability of enzymes under adverse environmental conditions. The invention also involves altering the net surface charge and surface charge distribution of enzymes to improve their performance in detergent formulations. The technical effects of the invention include improving the wash performance of subtilisin in laundry detergents and increasing the stability of enzymes under high or low detergent concentration conditions.

Problems solved by technology

However, later work demonstrated that this conclusion is not always applicable (See e.g., U.S. Pat. No. 6,673,590 B1).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for Improving Protein Properties
  • Methods for Improving Protein Properties
  • Methods for Improving Protein Properties

Examples

Experimental program
Comparison scheme
Effect test

example 1

Assays

[0173]The following assays were used in the examples described below. Any deviations from the protocols provided below are indicated in the examples. In these experiments, a spectrophotometer was used to measure the absorbance of the products formed after the completion of the reactions. A reflectometer was used to measure the reflectance of the swatches.

A. Protein Content Determination

[0174]1. BCA (bicinchoninic acid) Assay for Protein Content Determination

[0175]In these assays, BCA (Pierce) assay was used to determine the protein concentration in protease samples on a microtiter plate (MTP) scale. In this assay system, the chemical and reagent solutions used were: BCA protein assay reagent, and Pierce Dilution buffer (50 mM MES, pH 6.5, 2 mM CaCl2, 0.005% TWEEN®-80). The equipment used was a SpectraMAX (type 340) MTP reader. The MTPs were obtained from Costar (type 9017).

[0176]In the test, 200 μl BCA reagent was pipetted into each well, followed by 20 μl diluted protein. Aft...

example 2

NprE Protease Production in B. subtilis

[0216]In this Example, experiments conducted to produce NprE protease in B. subtilis are described. In particular, the methods used in the transformation of plasmid pUBnprE into B. subtilis are provided. Transformation was performed as known in the art (See e.g., WO 02 / 14490, and U.S. patent application Ser. No. 11 / 581,102). The DNA sequence (nprE leader, nprE pro and nprE mature DNA sequence from B. amyloliquefaciens) provided below encodes the NprE precursor protein.

(SEQ ID NO: 1)GTGGGTTTAGGTAAGAAATTGTCTGTTGCTGTCGCCGCTTCCTTTATGAGTTTAACCATCAGTCTGCCGGGTGTTCAGGCCGCTGAGAATCCTCAGCTTACAAAGTGGAGCATGCCGCCACAACCGGAACAGGTACGACTCTTAAAGGAAAAACGGTCTCATTAAATATTTCTTCTGAAAGCGGCAAATATGTGCTGCGCGATCTTTCTAAACCTACCGGAACACAAATTATTACGTACGATCTGCAAAACCGCGAGTATAACCTGCCGGGCACACTCGTATCCAGCACCACAAACCAGTTTACAACTTCTTCTCAGCGCGCTGCCGTTGATGCGCATTACAACCTCGGCAAAGTGTATGATTATTTCTATCAGAAGTTTAATCGCAACAGCTACGACAATAAAGGCGGCAAGATCGTATCCTCCGTTCATTACGGCAGCAGATACAATAACGCAGCCTGGATCGGCGAC...

example 3

Generation of Site Evaluation Libraries (SELs)

[0224]In this Example, methods used in the construction of nprE SELs are described.

[0225]The pUBnprE vector, containing the nprE expression cassette described above, served as template DNA. This vector contains a unique BglII restriction site, which was utilized in the site evaluation library construction. Briefly, to construct a nprE site evaluation library, three PCR reactions were performed, including two mutagenesis PCRs to introduce the mutated codon of interest in the mature nprE DNA sequence and a third PCR used to fuse the two mutagenesis PCRs in order to construct the pUBnprE expression vector including the desired mutated codon in the mature nprE sequence.

[0226]The method of mutagenesis was based on the codon-specific mutation approach, in which the creation of all possible mutations at a time in a specific DNA triplet was performed using a forward and reverse oligonucleotide primer with a length of 25 to 45 nucleotides enclosi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Tmaaaaaaaaaa
Tmaaaaaaaaaa
Tmaaaaaaaaaa
Login to View More

Abstract

The present invention provides methods for engineering proteins to optimize their performance under certain environmental conditions of interest. In some embodiments, the present invention provides methods for engineering enzymes to optimize their catalytic activity under particular environmental conditions. In some preferred embodiments, the present invention provides methods for engineering enzymes to optimize their catalytic activity and / or stability under adverse environmental conditions. In some preferred embodiments, the present invention provides methods for engineering enzymes to optimize their storage stability, particularly under adverse environmental conditions. In some preferred embodiments, the present invention provides methods for altering the net surface charge and / or surface charge distribution of enzymes (e.g., metalloproteases) to obtain enzyme variants that demonstrate improved performance and / or stability in detergent formulations as compared to the starting or parent enzyme.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]The present application claims priority to U.S. Provisional Patent Application Serial Nos. 60 / 933,307, 60 / 933,331, and 60 / 933,312, filed on Jun. 6, 2007, hereby incorporated by reference in their entirety.FIELD OF THE INVENTION[0002]The present invention provides methods for engineering proteins to optimize their performance under certain environmental conditions of interest. In some embodiments, the present invention provides methods for engineering enzymes to optimize their catalytic activity under particular environmental conditions. In some preferred embodiments, the present invention provides methods for engineering enzymes to optimize their catalytic activity and / or stability under adverse environmental conditions. In some preferred embodiments, the present invention provides methods for engineering enzymes to optimize their storage stability, particularly under adverse environmental conditions. In some preferred embodiments, the pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N9/48C07K14/00C12N9/00C12N9/26C12N9/42C12N9/18C12N9/20C12N9/88C12N9/02C12N9/10C12N9/08
CPCC11D3/386C11D3/38681C12N9/2411C12Y304/21062C12N9/54C12N15/1034C12Y302/01001C12N9/2417C12N9/14C12N15/01C12N15/10C12N15/52
InventorAEHLE, WOLFGANGCASCAO-PEREIRA, LUIS GUSTAVOKELLIS, JR., JAMES T.SHAW, ANDREW
OwnerDANISCO US INC