Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling

a technology of transcription factor and effector, applied in the field of dcas9-effector system, can solve the problems of inability to influence the differentiation status of stem cells, and the inability of dcas9-effector system

Inactive Publication Date: 2015-07-09
UNIV OF CENT FLORIDA RES FOUND INC +1
View PDF1 Cites 113 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text mentions that kits may also include additional components such as opaque containers or stabilizers to prevent the reagents from becoming degraded by light or other negative conditions. These additions improve the efficiency and reliability of the reagents used in the kits.

Problems solved by technology

However, the ability of a dCas9-effector system (referred to herein as CRISPRe) to influence the differentiation status of stem cells has not been addressed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling
  • Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling
  • Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cas9 Effector-Mediated Regulation of Transcription and Differentiation in Human Pluripotent Stem Cells

[0170]a. sgRNA in Silico Design

[0171]Candidate sgRNAs were identified by searching for (G(N)20GG) motifs 300 bases upstream of the and 100 bases downstream of the transcriptional start site (TSS) that conform with the nucleotide requirements for U6 Pol III transcription and the spCas9 PAM recognition element (NGG) (Jinek et al., 2012 [23]; Mali et al., 2013b [4]). Bowtie2 was used to map candidate targets to the human genome (build GRCh37) (Langmead and Salzberg, 2012 [54]) with sensitive parameters (--local-f-k10--very-sensitive-local-L9-N1) to detect potential off-target sites. All the sgRNAs used herein had no other genomic matches at the alignment stringency used. See, Table 3.

TABLE 3sgRNAsPosi-TargettionPro-toTargetTarget SequenceNamemoterTSSStrand(including PAM)OCT4Aoct4−158templateGGGGCGCCAGTTGTGTCTCCCGGisoform(SEQ ID No: 1)AOCT4Aoct4−12templateGTGGGACTGGGGAGGGAGAGAGGisoform(...

example 2

dCas9-Mediated Reprogramming of Human Fibroblasts to iPSCs

[0186]Since the groundbreaking work by Yamanaka and colleagues [15] that demonstrated the feasibility of reprogramming cellular identity with OCT4, SOX2, KLF4 and cMYC (OSKM), intense scientific effort has focused on understanding the mechanism of this process and improving it through the identification of additional collaborating TFs and the substitution / inclusion of small molecules or non-coding RNAs [25]. Artificial TFs that activate expression of individual TFs within the OSKM set can substitute for a single factor (e.g. SKM with a TALE-VP64 fusion that activates OCT4 can reprogram fibroblasts to iPSCs [36]). Fibroblast reprogramming to iPSCs will be used as a framework for the initial demonstration the multi-target activation via dspCRSIPRa can yield functional differentiation state choices. Initial experiments will focus on the iterative substitution of single OSKM factor with a dspCas9-VP64 effector targeting one of th...

example 3

[0188]Identification Of Factors Generating A Definitive Endoderm (DE) From hESCs

[0189]The first major differentiation state from ESCs to endodermal lineages may involve the transition to DE [60-62]. Monolayer cell culture conditions that efficiently generate DE through activation of the wingless (WNT) and TGFβ signaling pathways are well defined [60, 63]. This well-defined lineage will be used to test the ability of the CRISPRe / i system to program cell fate decisions (Schematic overview of the approach given in FIG. 8A). As a testing ground, directing hESCs to an endodermal fate has several benefits: First, diagnostic markers of DE have been defined (e.g. CXCR4, GATA3, FOXA3, etc.) [60, 63-66], and detection of intracellular SOX17 with FOXA2 or surface expression of CXCR4 and c-Kit have been used to distinguish DE from ESCs by FACS [60, 64, 67]. This provides a robust and sensitive assay for the identification of cells that have differentiated from hESCs to DE. Second, critical fact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Distanceaaaaaaaaaa
Fluorescenceaaaaaaaaaa
Login to View More

Abstract

The present disclosure relates to methods of and systems for modifying the transcriptional regulation of stem or progenitor cells to promote their differentiation or reprogramming of somatic cells. Further, the labeling and editing of human genomic loci in live cells with three orthogonal CRISPR / Cas9 components allow multicolor detection of genomic loci with high spatial resolution, which provides an avenue for barcoding elements of the human genome in the living state.

Description

STATEMENT OF GOVERNMENTAL SUPPORT[0001]This invention was made with government support awarded by the National Institutes of Health (Grant Number R01GM68110). The government has certain rights in the invention.FIELD OF THE INVENTION[0002]The present disclosure relates to methods of and systems for modifying the transcriptional regulation of stem or progenitor cells to promote their differentiation or reprogramming of somatic cells. Further, the invention related to methods of and systems for target-sequence specific gene editing and labeling.BACKGROUND OF THE INVENTION[0003]Recently, an RNA-guided adaptive immune system that is widespread in bacteria and archaea [1] has been engineered for targeted DNA cleavage or gene regulation in prokaryotic and eukaryotic genomes [2]. Such a system could provide a platform for the systematic and high throughput identification of factors relevant to stem cell differentiation and maintenance if applicable to human pluripotent stem cells (hPSCs) or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/86C12Q1/68C12N5/073C12N5/074
CPCC12N15/86C12N5/0696C12N2800/80C12N5/0603C12N2740/15043C12Q1/6841C12N5/0606C12N9/22C12N15/63C12N15/907C12N2501/65C12N2501/70C12N2510/00
InventorWOLFE, SCOT ANDREWMA, HANHUIPEDERSON, THORUENUAMEH, METEWO SELASE KOSIKEARNS, NICOLA ANNEGENGA, RYAN MICHAEL JUDEMAEHR, RENEZHANG, SHAOJIENASERI, ARDALANGARBER, MANUEL
OwnerUNIV OF CENT FLORIDA RES FOUND INC