Recombinant protein production system
a protein and recombinant technology, applied in the field of recombinant protein production system, can solve the problems of inability to glycosylate proteins, inefficient post-translational modification, and inability to cleave pre- or pre-pro sequences from proteins, so as to improve the yield and quality of protein production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
n of a Stable Cell Model Expressing the RPL10 R98S Mutation
[0092]shRNA+Overexpression Model
[0093]Mouse lymphoid pro-B cells (Ba / F3) were transduced with retroviral vectors encoding WT and R98S mutant RPL10 according to standard methods. These retroviral constructs were described previously (De Keersmaecker et al. (2013) cited above). T-ALL samples containing the RPL10 R98S defect only express mutant RPL10 (De Keersmaecker et al. (2013) cited above). To mimic this, endogenously expressed Rpl10 was knocked down in the Ba / F3 cell lines by transduction with an Rpl10 targeting shRNA construct. To generate this shRNA construct, a short hairpin RNA sequence (AACCGACGATCCTATTGTCATC: SEQ ID NO:7) targeting mouse Rpl10 was cloned into a mir30 cassette that was introduced into the pMSCV-Neo vector. In order to obtain cells with efficient and stable knock down of endogenous Rpl10, cultures were established from single cell colonies grown in Clonacell-TCS medium (Stemcell technologies). Only cul...
example 2
Labelling Assay to Determine Levels of Freshly Synthesized Proteins
[0098]Click-iT technology (Thermo Fisher Scientific) was employed to measure the levels of newly synthesized proteins in Ba / F3 cells. Briefly, 2 million cells were placed in methionine-free medium for 1 hour and then labelled for 2 hours with 35 μM AHA (L-azidohomoalanine). Cells were then lysed in lysis buffer (Cell Signalling Technology) and 100 μg of protein extract was used to perform the Click-iT biotin-conjugating reaction according to manufactures instruction. Subsequently, proteins were separated by gel electrophoresis and newly synthesized proteins were detected by immunoblot using a streptavidin-HRP antibody (Cell Signalling Technology).
example 3
of GFP Expression
[0099]The plasmid used for expressing RPL10 WT or R98S in the Ba / F3 shRNA / overexpression model contains an IRES-GFP expression cassette. Expression levels of this cassette were monitored by measuring the mean fluorescent intensity (MFI) on a Guava Easycyte HT flow cytometer (Millipore). For the Jurkat RPL10 WT or R98S cells, a plasmid encoding a GFP expression cassette was electroporated and expression levels of this cassette were determined by measuring the mean fluorescent intensity (MFI) on a Guava Easycyte HT flow cytometer (Millipore) at 24 hours after electroporation.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Fraction | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More