Compounds and methods for reducing fxi expression

a technology of fxi and compound, applied in the field of compound and method for reducing fxi expression, can solve the problems of increased bleeding, increased morbidity, and complicated warfarin drug therapy, and achieve the effects of reducing fxi protein activity, reducing rna, and reducing the amount of fxi protein

Pending Publication Date: 2021-11-18
IONIS PHARMA INC
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The oligomeric compounds effectively reduce Factor XI protein activity in the blood, thereby treating or preventing thromboembolic conditions without the adverse effect of increased bleeding, providing a safer therapeutic option for patients at risk of these conditions.

Problems solved by technology

Thrombosis is the pathological development of blood clots, and an embolism occurs when a blood clot migrates to another part of the body and interferes with organ function.
Significantly, thromboembolism is a major cause of morbidity affecting over 2 million Americans every year.
Drug therapy using warfarin is further complicated by the fact that warfarin interacts with other medications, including drugs used to treat atrial fibrillation, such as amiodarone.
Because therapy with warfarin is difficult to predict, patients must be carefully monitored in order to detect any signs of anomalous bleeding.
Treatment with heparin may cause an immunological reaction that makes platelets aggregate within blood vessels that can lead to thrombosis.
This side effect is known as heparin-induced thrombocytopenia (HIT) resulting in increased bleeding and requires patient monitoring.
Prolonged treatment with heparin may also lead to osteoporosis.
Rivaroxaban, Dabigatran, and Edoxaban all exhibit increased bleeding, especially increased GI bleeding risk compared to warfarin.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compounds and methods for reducing fxi expression
  • Compounds and methods for reducing fxi expression
  • Compounds and methods for reducing fxi expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

f Compound No. 416858 and Compound No. 957943 in Transgenic Mice

[0377]Oligomeric compounds No. 416858 and 957943 were tested in a Factor XI PAC transgenic mouse model which uses bacterial P1 artificial chromosome (PAC) containing the entire WT human Factor XI gene. The mouse model was generated from a human FXI gene fragment containing the entire ˜24 Kb human FXI transgene as well as 9 Kb upstream and 6 Kb downstream. The gene fragment was microinjected into the pronucleus of fertilized mouse eggs, and the complete BAC integration of the transgene was confirmed by PCR using human specific primer probe sets. The established founder has predominate liver expression of human FXI RNA and circulating human FXI in plasma.

TABLE 1Oligomeric compounds complementary tohuman FXI5′ChemistrySEQCompoundModi-NotationIDNumberfication(5′ to 3′)NO:416858noneAesmesGesGesmCesAds3TdsTdsGdsGdsTdsGdsmCdsAdsmCdsAesGesTesTesTe957943(THA-AesmCeoGeoGeomCeoAds3GalNAc3)oTdsTdsGdsGdsTdsGdsmCdsAdsmCdsAeoGeoTesTes...

example 2

ity of Oligomeric Compounds Complementary to Human Factor XI in Cynomolgus Monkeys

[0381]Compound No. 416858 was administered to cynomolgus monkeys at 4, 8, 12, and 40 mg / kg / week by subcutaneous injection for 13 weeks, as described in Husam, et. al., “Antisense inhibition of coagulation factor XI prolongs APTT without increased bleeding risk in cynomolgus monkeys”, Blood, 2012, 119: 2401-2408, incorporated by reference herein in its entirety.

[0382]Compound No. 957943 was administered to groups of 14-18 cynomolgus monkeys, half male and half female, at 1, 6, and 25 mg / kg once a month or 1.5 mg / kg weekly by subcutaneous injection. Platelet levels were measured during routine CBC measurements.

TABLE 4Platelet Counts in Cynomolgus Monkeys after Treatmentwith Compound No. 416858, measured at day 93Dose (weekly)none481240(PBS)mg / kgmg / kgmg / kgmg / kgPlatelets (×103 / μL)506516452404357

TABLE 5Platelet Counts in Cynomolgus Monkeys after treatmentwith Compound No. 957943 for up to 87 daysDose1.51625...

example 3

f Compound No. 416858 and Compound No. 957943 In Vitro in HepatoPac® Cells

[0383]The HepatoPac® kit is a commercially-available in vitro liver model system available from BIOIVT that consists of micropatterned hepatocyte “islands” co-cultured with supportive stromal cells. A 96-well HepatoPac plate was equilibrated for 48 hours at 37° C. and 10% CO2 in fresh maintenance medium prior to treatment. Oligomeric compounds were diluted into maintenance medium at 0.0002, 0.0020, 0.0200, 0.2000, 2.0000, or 20.0000 μM for 48 hours. After 48 hours, medium was replaced with fresh maintenance medium without additional compound. Cell lysates were collected at 96 hours post compound addition and analyzed by RT-PCR using primer probe set RTS2966 (forward sequence CAGCCTGGAGCATCGTAACA, designated herein as SEQ ID NO: 7; reverse sequence TTTATCGAGCTTCGTTATTCTGGTT designated herein as SEQ ID NO: 8; probe sequence TTGTCTACTGAAGCACACCCAAACAGGGA designated herein as SEQ ID NO. 9.). IC50 was calculated us...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of FXI RNA in a cell or subject, and in certain instances reducing the amount of FXI protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to prevent, treat, or ameliorate at least one symptom of a thromboembolic condition without a significant increase in a bleeding risk. Such thromboembolic conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition. Such symptoms include decreased blood flow through an affected vessel, death of tissue, and death.

Description

SEQUENCE LISTING[0001]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0337WOSEQ_ST25.txt, created on Apr. 29, 2019, which is 40 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.FIELD[0002]Provided herein are compounds, methods, and pharmaceutical compositions for reducing an amount of Factor XI (FXI) RNA in a cell or animal, and in certain instances reducing the amount of FXI protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to treat or prevent a thromboembolic condition. In certain embodiments, the compounds, methods, and pharmaceutical compositions are useful to treat or prevent a thromboembolic condition without increasing bleeding risk. Such thromboembolic conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/113
CPCC12N15/1137C12N2310/315C12N2310/11C12N2310/3341C12N2310/322C12N2310/321C12N2310/341C12N2320/30A61K31/70C12Y304/21027C12N2310/345C12N2310/346C12N2310/3515A61K31/7088C12N2310/3525C12N15/113A61P9/10A61P13/12C12N2310/14
InventorBUI, HUYNH-HOA
OwnerIONIS PHARMA INC