Method for separating cotton chloroplast DNA

A chloroplast and cotton technology, applied in the field of plant genetic engineering, can solve the problems of expensive, time-consuming, low yield, etc., and achieve the effect of saving experiment cost, low price and high quality

Inactive Publication Date: 2008-02-06
HUAZHONG AGRI UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is costly, time-consuming, and yields low
At the same time, due to the relatively high requirements for experimental equipment, especially the need for expensive ultra-high-speed centrifuges and homogenizers, the wide application of the above methods is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for separating cotton chloroplast DNA
  • Method for separating cotton chloroplast DNA
  • Method for separating cotton chloroplast DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The experimental material in this example is the upland cotton standard line Tm-1 (Lin et al., 2003). Take 50g of young cotton leaves planted in the field or in a tray, wash them with distilled water, dry them slightly, put them in a fresh-keeping bag and starve them overnight in a dark place, or store them at -70°C for later use.

[0059] 1. Isolation of intact chloroplasts

[0060] (1) Take the newly expanded young leaves of cotton plants in the field as materials for separating cotton chloroplasts, place the leaves in a refrigerator (4°C) for 24 hours in the dark, and then transfer them to an ultra-low temperature (-70)°C refrigerator for storage (or directly use About 50 grams of leaves were weighed for separation of chloroplasts. Cool the juicer with ice cubes in advance, then add 4 times the volume of sample pre-cooled buffer A at 4°C to the juicer, quickly add the sample to the container, start the juicer, homogenize for about 1min, and then use Filter the homo...

Embodiment 2

[0100] Gel electrophoresis and UV spectrophotometer to detect the quality of cpDNA:

[0101] 5 μL of extracted chloroplast DNA was electrophoresed on 0.8% agarose gel with 90V×60mA for 30min, and placed in a BIO-RAD gel imaging system to observe and image the results. After 4 μL of cpDNA was diluted 50 times, D260nm and D280nm were measured on a Beckman-DU 800 UV spectrophotometer.

[0102] It can be seen from Figure 1 that the size of the extracted cpDNA fragment is about 20,000 bp, and the band pattern is uniform, indicating that the purity of the cpDNA is high, and there is no obvious tailing and dispersion phenomenon, indicating that the integrity of the extracted DNA is relatively good.

[0103] The results of ultraviolet spectrophotometry can also be seen that the D of most samples 260 / D 280 Between 1.6-1.8, it shows that the purity of cpDNA is higher (Table 1).

[0104] Table 1 Cotton cpDNA D 260 and D 280 The measurement results

[0105] the batch

...

Embodiment 3

[0111] PCR detection of DNA extraction and purification effect:

[0112] The promoter and terminator primers of the psbA gene were designed as follows:

[0113] Promoter primer: forward primer: 5'-CCCGGGCAACCCATTTTTAGTATC-3'; reverse primer:

[0114] 5'-TTAATCATCAGGGACTCCCAAGCG-3'.

[0115] Terminator primer: forward primer 5′AGACTTTGGTTTTAGTGTATACGAG 3′;

[0116] Reverse primer 5'-TGCCTTGATCCACTTGGCTACA-3'.

[0117] The expected amplified fragments are 310, 380bp psbA gene promoter and terminator fragments respectively.

[0118] 20ul system for PCR amplification procedure:

[0119] Taq polymerase 1mol / L, 25mmol / L MgCl2 1.5μL, 10mmol / L dNTP 0.5μL, 10×Buffer 2.5μL, 10μmol / L forward and reverse primers 0.25μL each, template DNA 40ng, total volume 25μL. PCR reaction program: 94°C pre-denaturation for 5 min, followed by 94°C denaturation for 1 min, 58°C annealing for 30 s, 72°C ligation for 1 min cycle 38 times, and finally 72°C extension for 5 min. The PCR reaction was car...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the cotton genetic engineering technical field, in particular to a new method for separating the chloroplast DNA of cotton. The present invention includes: young and tender leaves are taken as material, and are fully homogenated by a common domestic juicer, four kinds of buffer solutions of A, B, C, and D are utilized, the leaves are centrifuged at a general velocity, and the cotton chloroplast DNA pure can be finally obtained successively by the separating and the cracking of the chloroplast as well as the separating and the purifying of the chloroplast DNA (cpDNA). The quality of the chloroplast DNA prepared and separated by the present invention is higher, and the UV spectrophotometer measuring shows that the D260 nm / D280 nm of a DNA sample prepared by the present invention is set between 1.6 and 1.8; the leaf sample yields up to 1-10 microgram cpDNA per gram. After being verified, taking the separated cpDNA as the template can completely satisfy the common molecular biological operation needs such as the specific enzyme restriction, the RAPD, the PCR, the clone of target gene sequences, and so on. Compared with the prior art, the present invention does not need a hypervelocity centrifugal machine, and equipments and steps of centrifugalization through the sucrose density gradient are also not needed.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to a method for isolating cotton chloroplast DNA. Background technique [0002] Chloroplast is the main organelle for photosynthesis in green plants. Although the expression of its function depends on the nucleus, it still has a relatively independent genetic material, namely chloroplast DNA (cpDNA). Most of the chloroplast genomes of higher plants are between 120-160kb in size, and their DNA molecules exist in the form of covalent, closed, and circular double strands. The genes in the molecules are closely arranged, and there are few internal element insertion sequences. The chloroplast genome encodes many important components related to photosynthesis and chloroplast protein synthesis, and some of these genes can be used in molecular biology research to improve crop yield and endow crops with herbicide resistance traits, etc., thus arousing widespread interest of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/29
Inventor张献龙金双侠刘小云刘冠泽唐文鑫聂以春郭小平
OwnerHUAZHONG AGRI UNIV