CDNA sequence of coding perinereis albuhitensis grube protease and amino acid sequence thereof

A technology of nereid biloba and protease is applied in the field of cDNA sequence of nereid protease and its amino acid sequence, and can solve the problems of complicated purification process, limited development and utilization, low content of protease and the like

Inactive Publication Date: 2008-05-28
QINGDAO UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low content of protease in clamworm and the complicated purification process, its development and utilization are limited.
With the rapid development of molecular biology technology, the produc

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CDNA sequence of coding perinereis albuhitensis grube protease and amino acid sequence thereof
  • CDNA sequence of coding perinereis albuhitensis grube protease and amino acid sequence thereof
  • CDNA sequence of coding perinereis albuhitensis grube protease and amino acid sequence thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Construction of a cDNA library of C. didentate and the cloning of a cDNA encoding protease:

[0046] 1. Using 2 g of Nereis cerevisiae didentate live tissue as material, total RNA was extracted using RNAiso Reagent (TaKaRa Code No.D312).

[0047] 2. Use Oligotex-dT30 mRNA Purification Kit (TaKaRa Code No.9086) to extract mRNA.

[0048] 3. Using 5 μg mRNA as a template, use the TaKaRa cDNA library construction kit to construct a cDNA library, specifically including the following steps:

[0049] (1) Use reverse transcriptase M-MLV and Oligo (dT) anchor primer to synthesize the first strand of cDNA, using 5-methyl dCTP during synthesis;

[0050] (2) Utilize RNaseH, Escherichia coli DNA polymerase and DNA ligase to synthesize the second strand of cDNA;

[0051] (3) smoothing the ends of the double-stranded cDNA using T4 DNA polymerase;

[0052] (4) Ligate with the linker containing the NotI recognition sequence, and then digest with NotI;

[0053] (5) Use DNA...

Embodiment 2

[0074] Example 2: Construction of expression vector and expression of cDNA in Escherichia coli:

[0075] 1. According to the obtained cDNA sequence, design a pair of primers

[0076] Primer 1: ACATATGCTGAATGGACCAAG, Primer 2: ACCCTCGAGGAAACCTAAAGTC

[0077] Using the cDNA of C. bidentata protease as a template, Taq DNA polymerase was used to amplify the DNA fragment without the signal peptide coding region. The amplification conditions were: denaturation at 94°C for 45 sec, annealing at 50°C for 45 sec, and extension at 72°C for 1 min. A 700bp fragment was obtained (in FIG. 1: 1. PCR product; 2. λDNA / EcoR I+HindIII).

[0078] 2. After cutting with NdeI and XhoI, clone it into the expression vector pET-15b to construct the expression vector pET-15bP, transform the expression vector into E.col iBL21(DE3), and construct the engineering bacteria.

[0079] 3. Pick a single colony of engineering bacteria, inoculate it in 20ml of LB medium containing 100μg / ml ampicillin, culture it...

Embodiment 3

[0081] Embodiment 3: Separation and purification of recombinant Bidentate nereis protease

[0082] 1. The lysate of the engineered bacteria induced to express was ultrasonically disrupted, centrifuged at 15,000×g for 30 min at 4°C, and the supernatant was taken.

[0083] 2. The supernatant flows through Ni 2+ Resin column (2.6×8cm), with 100ml washing solution (20mM, pH 8.0, 50mM imidazole, 0.5M NaCl).

[0084] 3. Elute the binding protein with elution buffer (20mM, pH8.0, 500mM imidazole, 0.5MNaCl) to obtain the recombinant Bidentate nereis protease, the recombinant protein is 28kDa (Figure 3: 1. Medium molecular weight standard protein; 2. Unbound miscellaneous protein; 3. Recombinant Bidentate nereis protease).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a coding cDNA sequence and amino acid sequence of coding perinereis aibuhitensis grube protease, as sequence 1 and sequence 2 of the sequence table show respectively, wherein, the full length of cDNA is 839bp, the length of coding nucleotide sequence of perinereis aibuhitensis grube protease is 765 bp, the full length of the coding amino acid sequence of perinereis aibuhitensis grube protease is 254 amino acid residues and the invention comprises 22 signal peptide composed by amino acid residues, which belongs to biomedicine field. According to the coding cDNA sequence of nereis protease of the invention, the encoding gene of protease can be cloned from cDNA library of the perinereis aibuhitensis grube, the encoding gene can be expressed in eukaryotic expression system and prokaryotic expression system by gene recombination technique. The recombined nereis protease is provided with original activated activity of fibrinferment, which can be used as thrombolytic drug to prevent or cure myocardial infarction, cerebral arterial thrombosis and the like.

Description

Technical field: [0001] The invention relates to a cDNA sequence and an amino acid sequence encoding nereis protease with plasminogen activation activity and belongs to the field of biomedicine. Background technique: [0002] Proteases are a class of hydrolytic enzymes distributed in animals, plants and microorganisms that can specifically hydrolyze peptide bonds, some of which are serine endoproteases. Physiological effect. Thrombotic disease is one of the diseases that middle-aged and elderly people are prone to, and the number of young patients is also on the rise. At present, the main method of treating thrombosis is thrombolytic therapy, that is, injection of thrombolytic agent to recanalize blood vessels. Therefore, the development of highly effective thrombolytic drugs is of great clinical significance. [0003] Nereis didentate is a marine annelid widely distributed in the coast of my country, often used as bait, and as a traditional Chinese medicine, it has the e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/58C12N9/64A61K38/49A61P9/10A61P7/02
Inventor 李荣贵杜桂彩王斌
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap