Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant saccharomyces cerevisiae for producing ethanol by using xylose and glucose

A technology for recombining Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of bioengineering and can solve problems such as ineffective fermentation of xylose to produce ethanol

Inactive Publication Date: 2008-06-25
NANJING UNIV OF TECH
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Saccharomyces cerevisiae has a complete pathway of xylose metabolism, but cannot efficiently ferment xylose to produce ethanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant saccharomyces cerevisiae for producing ethanol by using xylose and glucose
  • Recombinant saccharomyces cerevisiae for producing ethanol by using xylose and glucose
  • Recombinant saccharomyces cerevisiae for producing ethanol by using xylose and glucose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Starting strain:

[0053] The starting strain is Saccharomyces cerevisiae YPH499 (purchased from Stratagene, USA), which is deficient in leucine, histidine and uracil.

[0054] Medium:

[0055] Basic medium (YPD): Yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.

[0056] Screening medium: 6.7g of amino acid-free yeast nitrogen source (YNB), 1.3g of essential amino acid mixture (lacking uracil),

[0057] Xylose 20g, agar powder 20g, deionized water to 1L.

[0058] Add 2% agar when preparing solid plate medium

[0059] Mutagenesis and screening of mutants:

[0060] A ring of Saccharomyces cerevisiae YPH499 was added to the basic medium from a fresh slant, cultured at 30°C and 200r / min for 14 hours, the bacteria were collected by centrifugation, and the YPH499 genome was extracted using the Yeast Genome DNA Extraction Kit (TIANGEN) to obtain the YPH499 genome as a template. Primer SPT15_Sense: TCGAGTGCTAGCAAAATGGCCGATGAGGAACGTTTAAAGG (SEQ ID No.2) an...

Embodiment 2

[0062] Seed medium: yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.

[0063] Fermentation medium: yeast powder 10g, peptone 20g, xylose 50g, deionized water to 1L.

[0064] Connect the saccharomyces cerevisiae YPH499-3 that a ring embodiment 1 obtains from fresh slope, CGMCC No.2255 inserts in the 50ml Erlenmeyer flask that seed culture medium is housed, at 30 ℃, the shaker of 200rpm (Taicang Experimental Equipment Factory ) after cultivating 24h, insert in the conical flask that fermentation medium is housed with 1% inoculum amount (v / v), at 30 ℃, cultivate in the shaker of 200rpm, ferment 72h, the utilization rate of gained xylose is 94%, ethanol yield was 5%.

Embodiment 3

[0066] Seed medium: yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.

[0067] Fermentation medium: yeast powder 10g, peptone 20g, xylose 25g, glucose 25g, deionized water to 1L.

[0068] Connect a ring from the fresh slant by the Saccharomyces cerevisiae YPH499-3 that embodiment 1 obtains, and CGMCC No.2255 inserts in the Erlenmeyer flask that seed culture medium is housed, at 30 ℃, the shaker of 200rpm (Taicang Experimental Equipment Factory ) after cultivating 24h, insert in the conical flask that fermentation medium is housed with 1% inoculum amount (v / v), at 30 ℃, cultivate in the shaker of 200rpm, ferment 72h, the utilization rate of gained xylose is 91%, the utilization rate of glucose is 85%, and the yield of ethanol is 10%.

[0069]

[0070]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the bioengineering technical field and discloses a Saccharomyces cerevisiae YPH499-3 which has been collected in China General Microbiological Culture Collection Center of China Committee for Culture Collection of Microorganisms with a collection number of CGMCC No.2255. The Saccharomyces cerevisiae of the invention can well utilize xylose and also can simultaneously transport the xylose and glucose to produce ethanol, and utilization rate reaches over 80 percents.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a recombinant Saccharomyces cerevisiae YPH499-3 capable of utilizing xylose and simultaneously utilizing xylose and glucose to produce ethanol. Background technique [0002] Lignocellulose is the most abundant biomass resource in the world, with the largest amount and the cheapest price. The total annual output accounts for about 50% of all biomass resources. At present, most of these substances are not well utilized. The use of lignocellulose-based renewable biomass resources to produce renewable energy has important economic and social significance. As a clean and renewable energy source, industrial ethanol produced from biomass is an inevitable trend to replace fossil fuels such as petroleum. Traditional bioethanol production is mainly based on grain fermentation. The shortage of food in the world severely limits the source of raw materials, and the cost of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P7/06C12R1/865
CPCY02E50/17Y02E50/10
Inventor 严明许琳刘红梅来灿钢欧阳平凯
Owner NANJING UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More