Recombinant saccharomyces cerevisiae for producing ethanol by using xylose and glucose
A technology for recombining Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of bioengineering and can solve problems such as ineffective fermentation of xylose to produce ethanol
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Starting strain:
[0053] The starting strain is Saccharomyces cerevisiae YPH499 (purchased from Stratagene, USA), which is deficient in leucine, histidine and uracil.
[0054] Medium:
[0055] Basic medium (YPD): Yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.
[0056] Screening medium: 6.7g of amino acid-free yeast nitrogen source (YNB), 1.3g of essential amino acid mixture (lacking uracil),
[0057] Xylose 20g, agar powder 20g, deionized water to 1L.
[0058] Add 2% agar when preparing solid plate medium
[0059] Mutagenesis and screening of mutants:
[0060] A ring of Saccharomyces cerevisiae YPH499 was added to the basic medium from a fresh slant, cultured at 30°C and 200r / min for 14 hours, the bacteria were collected by centrifugation, and the YPH499 genome was extracted using the Yeast Genome DNA Extraction Kit (TIANGEN) to obtain the YPH499 genome as a template. Primer SPT15_Sense: TCGAGTGCTAGCAAAATGGCCGATGAGGAACGTTTAAAGG (SEQ ID No.2) an...
Embodiment 2
[0062] Seed medium: yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.
[0063] Fermentation medium: yeast powder 10g, peptone 20g, xylose 50g, deionized water to 1L.
[0064] Connect the saccharomyces cerevisiae YPH499-3 that a ring embodiment 1 obtains from fresh slope, CGMCC No.2255 inserts in the 50ml Erlenmeyer flask that seed culture medium is housed, at 30 ℃, the shaker of 200rpm (Taicang Experimental Equipment Factory ) after cultivating 24h, insert in the conical flask that fermentation medium is housed with 1% inoculum amount (v / v), at 30 ℃, cultivate in the shaker of 200rpm, ferment 72h, the utilization rate of gained xylose is 94%, ethanol yield was 5%.
Embodiment 3
[0066] Seed medium: yeast powder 10g, peptone 20g, glucose 20g, deionized water to 1L.
[0067] Fermentation medium: yeast powder 10g, peptone 20g, xylose 25g, glucose 25g, deionized water to 1L.
[0068] Connect a ring from the fresh slant by the Saccharomyces cerevisiae YPH499-3 that embodiment 1 obtains, and CGMCC No.2255 inserts in the Erlenmeyer flask that seed culture medium is housed, at 30 ℃, the shaker of 200rpm (Taicang Experimental Equipment Factory ) after cultivating 24h, insert in the conical flask that fermentation medium is housed with 1% inoculum amount (v / v), at 30 ℃, cultivate in the shaker of 200rpm, ferment 72h, the utilization rate of gained xylose is 91%, the utilization rate of glucose is 85%, and the yield of ethanol is 10%.
[0069]
[0070]
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap