Method for detecting DNA, RNA and ultramicro-amount protein

A protein, ultra-trace technology, applied in the field of DNA detection, can solve the problems of false positives, low sensitivity and high requirements for experimental conditions

Inactive Publication Date: 2008-08-27
广州市搏克生物技术有限公司
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Various technologies have their advantages and disadvantages. Nucleic acid amplification technology has high sensitivity, but it is prone to false positives and false negatives, and requires high experimental conditions; hybridization technology is simple and easy to automate, and has good repeatability, but its sensitivity is low and the cost of reagents is expensive; The technique is highly sensitive, convenient, and low in cost, but quantification requires special instruments, and it is not easy to standardize and perform large-scale detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting DNA, RNA and ultramicro-amount protein
  • Method for detecting DNA, RNA and ultramicro-amount protein
  • Method for detecting DNA, RNA and ultramicro-amount protein

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0014] 1. Preparation of magnetic bead capture probe: magnetic beads with free-NH3 on the surface, and capture probe 1 with -SH at the end (3 with -SH at the end, PEG and 10 consecutive A in the middle, As a spacer bridge sequence, the 5-terminus is a 18-25bp base sequence complementary to the 3-terminus of the detection target DNA) Use glutaraldehyde to connect the amino group and the sulfhydryl group, so that the capture probe 1 is labeled on the surface of the magnetic bead to make a magnetic bead capture probe ( figure 1 ).

[0015] 2. Preparation of nano-binding probes: gold atoms of nano-gold particles form covalent bonds with capture probe 2 and barcode DNA (barcode DNA / capture probe 2 is 100:1) with -SH at the 5-terminus in aqueous solution , firmly bound to the surface of gold nanoparticles, gradually adding NaCl to a final concentration of 0.3M, so that the capture probe 2 and the barcode DNA stretch on the surface of gold nanoparticles (capture probe 2 has -SH at i...

Embodiment 1

[0022] Embodiment 1: the detection of DNA

[0023] 1. Primer design: Take the detection of the BamHI-W fragment DNA of EBV as an example (NCBI genbankaccession No: M15973).

[0024] Detect the sequence of BamHI-W fragment DNA:

[0025] 2091 CCATCCCTGA AGACCCAGCGGCCATTCTCTCTGGTAACGAGCAGAGAAGA

[0026] AGTAGAGGCC CGCGGCCATT GGGCCCAGAT TGAGAGACCA GTCCAGGGGC CCGAGGTTGG

[0027] AGCCAGCGGG CACCCGAGGT CC 2222.

[0028] (1), capture probe 1:5- GGG CTT GGC CGG GTC TAA -PEG-AAAAAAAAAA-SH-(C6)-3. (The underlined part is combined with EBV BamHI-W fragment DNA).

[0029] (2), capture probe 2: 5-SH-(C6)-AAAAAAAAAA-PEG- GGA GGG ACC GGG TGC TGG-3 (The underlined part is combined with EBV BamHI-W fragment DNA).

[0030] (3) Barcode DNA: 5-SH-(C6)-AAA AAA AAA A-PEG-GGA TTC TCA ACTCGT AGC T-Biotin-3.

[0031] (4) Positive detection of target DNA: Use EBV BamHI-W fragment DNA as a template to synthesize a positive control primer, 5-CCA GCA CCC GGT CCC TCC AAA AAA AAA TTA GAC CCGGCC...

Embodiment 2

[0061] Embodiment 2: Detection of RNA

[0062] 1. Primer design: Take the detection of HCV RNA as an example (NCBI accession No: EU482888, detection corresponding sequence nt 1-216).

[0063] (1), capture probe 1:5- AAC TAC TGT CTT CAC GCA GAA AGC -PEG-AAAAAAAAAA-SH-(C6)-3. (The underlined part binds to HCV 5-UTR nt 1-18 RNA).

[0064] (2), capture probe 2: 5-SH-(C6)-AAAAAAAAAA-PEG- CCC AAC ACT ACT CGG CTA G-3 (The underlined part binds to HCV 5-UTR nt 198-216 RNA).

[0065] (3) Barcode DNA: 5-SH-(C6)-AAAAAAAAAA-PEG-GGA TTC TCA ACT CGTAGC T-Biotin-3.

[0066] (4) Positive detection of target RNA: WHO HCV standard.

[0067] 2. Preparation of magnetic bead capture probe:

[0068] (1) Take 1ml of magnetic beads with a diameter of 1 μm and free-NH3 on the surface, add 4ml of PBS (0.01M, pH 7.4,) and shake well, absorb the magnetic beads with a magnet, and remove the supernatant; repeat three times, remove the supernatant.

[0069] (2) Prepare fresh 5% glutaraldehyde solu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a process for detecting DNA, RNA and ultramicro protein, which can easily remove uncombined probe and other foreign matter through firstly sandwiching the ELISA detecting target molecular in liquid phase with capture probe 1 (can be ribonucleotide or antibody) on bead capture probe and capture probe 2 (can be ribonucleotide or antibody) on nano combining probe, and then absorbing magnetic beads with magnet. The detecting target molecular is amplified thousands of times since nano probe combining probe is combined with thousands of bar code DNA which is marked with biotin, each molecular bar code DNA can combine with 3 molecular DNA sequence which comprises T7 RNA promoter through utilizing a streptavidin-biotin system, thereby quantitatively detecting bar code DNA with the TMA technology, wherein bar code DNA is in proportion to target molecular content. The TMA technology can transcribe out of 10 thousand molecular DNA for special DNA sequence which comprises T7 RNA promoter in 3 hours according to a molecular DNA template, and can relatively amplify 10 thousand times bar code DNA.

Description

technical field [0001] The present invention relates to the use of DNA barcode-nano gold-T 7 RNA Transcription Amplification (Bio-DNA TMA) is a technique for detecting DNA, RNA and ultra-trace proteins. Background technique [0002] Quantitative detection of DNA, RNA and protein at the clinical molecular level has been widely used in disease diagnosis, disease efficacy and prognosis judgment. At present, fluorescent quantitative PCR and RT-PCR are generally used. 7 RNA transcription-mediated hybridization-protected luminescence (TMA-HPA) detects DNA and RNA content, and luminescence ELISA detects trace proteins. In addition, there is also a class of nucleic acid detection methods that do not require target molecule amplification, such as branched DNA hybridization (bDNA) and hybrid capture (Hybrid Capture, HC). In recent years, the detection of DNA, RNA, and trace protein technology developed by nanomaterials has attracted attention, such as the DNA barcode-nanoparticles ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68G01N33/577
Inventor刘万里曾木圣宋立兵
Owner广州市搏克生物技术有限公司