Process for quickly detecting DNA methylation

A methylation and rapid technology, applied in the field of medical biological detection, can solve the problems of long time for dialysis desalination, heavy workload, complicated operation, etc., and achieve the effect of saving desalination time, short detection time and improving repeatability.

Inactive Publication Date: 2008-10-15
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0039] This traditional detection method has the following disadvantages: 1. The operation is cumbersome, especially in the process of sodium bisulfite modification, the modification reaction is slow and takes a long time, usually 16-18 hours; 2. After the DNA is denatured into a single strand, the single The bases on the chain will also pair with each other, which may cause insufficient base exposure, resulting in incomplete sodium bisulfite modification, low experimental repeatability, and affecting the reliability of the results; 3. After sodium bisulfite modification, The desalting time of dialysis is also very long and the workload is heavy, which restricts the research of MS-PCR
However, if the DNA methylation detection kit (EZ DNA Methylation-Gold TM Kit), although the operation is convenient and the detection time is short, but the price is expensive, and the PCR template obtained each time can only be used for the methylation detection of 2 genes, which limits the multi-gene detection and cannot meet the needs of most experiments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for quickly detecting DNA methylation
  • Process for quickly detecting DNA methylation
  • Process for quickly detecting DNA methylation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1 Using the method of the present invention to detect the methylation of the p16 gene in liver cancer specimens

[0072] The samples to be tested were taken from individual samples of 3 liver cancer patients in Shanghai Oriental Hepatobiliary Hospital. The p16 gene has been shown to be hypermethylated in liver cancer (Naoyuki Umetani, MichielF.G.de Maat, Eiji Sunami, Suzanne Hiramatsu, Steve Martinez, and Dave S.B. Hoon Methylation of p16 and Ras Association Domain Family Protein 1a during Colorectal Malignant Transformation), However, liver cancer cannot be diagnosed by the hypermethylation of a gene, and not all patients with liver cancer will have hypermethylation of the p16 gene, and the methylation of the p16 gene is only one of the reference indicators. The operation steps are as follows (the three samples have the same method):

[0073] 1. Prepare the DNA to be tested:

[0074] Take 50 mg of fresh liver tissue, and extract DNA with a genomic DNA extract...

Embodiment 2

[0114] Embodiment 2: Comparative experiment of the method of the present invention and traditional method, kit method detection GSTP1 gene methylation

[0115] Design and synthesize methylation-specific primers and unmethylation-specific primers based on the GSTP1 gene, including forward primers and reverse primers (synthesized by Shanghai Bocai Biotechnology Co., Ltd.):

[0116] Methylated Forward Primer (MF): TTCGGGGTGTAGCGGTCGTC

[0117] Methylation Reverse Primer (MR): GCC CCAATACTAAATCACGACG

[0118] Amplified fragment length: 101bp

[0119] Unmethylated forward primer (UF): GATGTTTGGGGTGTAGTGGTTGTT

[0120] Unmethylated reverse primer (UR): CCACCCCAATACTAAATCACA ACA

[0121] Amplified fragment length: 101bp

[0122] The PCR was divided into 2 tubes for amplification, one tube was amplified with methylation-specific primers, and the other tube was amplified with unmethylation-specific primers. The PCR reaction system and conditions were the same as in Example 1 (where...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the medical biology detection technical field and discloses a method for quickly detecting DNA methylation. Aiming at the disadvantages of the prior method, the method provided by the invention improves the following three aspects: 1. catalyst TAC and guanidine hydrochloride are added to accelerate the modification reaction; 2. short-time high-temperature melting is performed during the modification reaction for times so as to fully expose basic groups to transform cytimidine which is not made from methylation modification to sulfonated uracil; 3. aiming at fussy dialysis desalination steps after the modification, when a modified DNA product is purified, the modified DNA product is combined into a glass fiber membrane or pellosil or other pillars for washing desalination, then is treated by sulfated reagent and eluted, thereby obtaining a methylated PCR template which can be directly used for PCR augmentation and greatly saves desalination time. The method has low cost, short detection time and good repetitiveness.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, in particular to a method for rapidly detecting DNA methylation. Background technique [0002] Abnormal methylation of genes is closely related to the occurrence and development of tumors. In vertebrates, CpG dinucleotides are the main sites of DNA methylation. CpG often exists in clusters, and a section of DNA rich in CpG in the genome is called CpG island (CpGisland). CpG islands are often located near transcriptional regulatory regions, and the study of DNA methylation is inseparable from the study of CpG islands. Abnormal methylation has appeared in early cancer, precancerous lesions, and even some benign lesions. Hypermethylation of CpG islands in the promoter regions of multiple tumor suppressor genes has been found in precancerous lesions of many malignant tumors. According to reports, abnormal methylation of multiple genes related to pancreatic cancer has been detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor卫立辛张春东蒋国成徐赟张黎吴孟超
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY