Matrix metalloproteinase targeted recombined human tumor necrosis factor and preparation thereof

A tumor necrosis factor and matrix metal technology, which is applied in recombinant DNA technology, hybrid peptides, and introduction of foreign genetic material using vectors.

Inactive Publication Date: 2008-11-12
GUANGDONG MEDICAL UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because most of the conjugates used in clinical research over the years are prepared using mouse monoclonal antibodies, which often lead to HAMA reactions
In addition, the heterogeneity of the tumor cell population in terms of antigenicity and the weak antigenicity of tumor cells may also affect the efficacy of the conjugate
The pharmacological problem is mainly due to insufficient drug reaching the tumor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Matrix metalloproteinase targeted recombined human tumor necrosis factor and preparation thereof
  • Matrix metalloproteinase targeted recombined human tumor necrosis factor and preparation thereof
  • Matrix metalloproteinase targeted recombined human tumor necrosis factor and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1. Cloning of Human Tumor Necrosis Factor-α cDNA (pGEM-hTNF-α)

[0066] 1.PCR primers and their sequences (amplification product 650bp)

[0067] Sense primer: 5′CG GAATTC CTGCTGCACTTTGGAGTGATCG 3′

[0068] The underline is the EcoR I restriction site

[0069] Anti-sense primer: 5′GC GAGCTCG TTTGAGCCAGAAGAGGTTGAGGG 3′

[0070] The underline is the Sac I restriction site

[0071] 2. RT-PCR

[0072] Mononuclear cells were isolated from human venous blood according to conventional methods, and after being stimulated with LPS (100ng / ml) for 3 hours, total cellular RNA was extracted; RT-PCR reaction was carried out using this as a template, with a total reaction volume of 50 μl. The reaction conditions were: denaturation at 94°C for 1 min, annealing at 65°C for 1 min, extension at 72°C for 1 min, and a total of 30 cycles.

[0073] 3. Clone

[0074] After the PCR product was purified, it was digested with EcoRI and SacI, ...

Embodiment 2

[0075] Example 2. Construction of the collagen coding sequence recombinant plasmid pGEM-collagen

[0076] 1. Collagen repeat oligonucleotide sequence

[0077] The collagen sequence is characterized by an amino acid sequence of (Gly-X-Y)n, where X and Y represent any amino acid (proline is the best) except Gly (glycine), and n is any positive integer (representing the number of repetitions). Therefore, there are many sequences that meet this characteristic, for example: positive strand (65nt):

[0078] 5'CATGGGTCGTCGTGGTCCACCTGGTCCACCTGGCCCACCTGGCCCACCTGGTCCACCTGGTCCGG 3' negative strand (65nt):

[0079] 5′AATTCCGGACCAGGTGGACCAGGTGGGCCAGGTGGGCCAGGTGGACCAGGTGGACCACGACGACC 3′

[0080] Annealing to form double strands (Nco I enzyme site and EcoR I enzyme site with two separate bands in the double strand)

[0081] 2. Cloning

[0082] The double strand formed by annealing was directional ligated to pGEM-T Easy vector (NcoI and EcoRI double enzyme digestion), and transformed into...

Embodiment 3

[0083] Embodiment 3. Construction of the purpose fusion protein gene plasmid (pGEM-collagen-MMPnm-hTNF)

[0084] 1.PCR primers and their sequences

[0085] Since there are more than ten kinds of MMPs that have been discovered, they can be divided into five categories. Therefore, for each type of MMP, 2-4 corresponding suitable substrate sequences (realized by primer design) are designed and corresponding recombinant plasmids are constructed. For example:

[0086] Anti-sense primer (corresponding to the hTNF-α full-length cDNA stop codon and the following 3 base positions):

[0087] 5′GC GAGCTC TCCTCACAGGGCAATGATCCCAAAG 3′

[0088] The underline is the SacI restriction site

[0089] Sense primers (corresponding to positions 410-431 of hTNF-α full-length cDNA):

[0090] 5’ CGGAATTC GGTGGT………AGTGACAAGCCTGTAGCCCATGTTG 3’

[0091] Wherein, the underlined place is the restriction site of EcoR I, ... represents a suitable substrate sequence (there are many kinds) of a class of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to matrix metallic protease-directed recombination human tumor necrosis factor fused protein and a method for making the same. The amino acid sequence of the fused protein consists of three parts, i.e. a collagen sequence, a (a sort or a class of) human matrix metallic protease substrate sequence and a human tumor necrosis factor-alpha sequence (as shown in graph 1) which are arranged in turn from an N-end. When tumor necrosis factor-alpha is formed into a trimerical active form, the collagen sequence is formed into right hand triple helix, and plays a role in closing the recipient binding site of tumor necrosis factor-alpha along with the human matrix metallic protease substrate sequence. The specific cutting of the fused protein can be completed by matrix metallic protease excreted by a tumor tissue inside the tumor tissue so as to expose the recipient binding site of tumor necrosis factor-alpha and to represent cytotoxic activity; however, the fused protein does not represent cytotoxic activity in most normal tissues. The fused protein has tumor-targeting characteristics and the action of killing tumor cells, thereby having enormous application prospect in curing tumor.

Description

technical field [0001] The present invention relates to the field of genetically engineered protein drugs, more specifically, the present invention relates to matrix metalloproteinase-directed recombinant human tumor necrosis factor fusion proteins and a preparation method thereof. The amino acid sequences of these fusion proteins consist of three parts: starting from the N-terminal It is a collagen sequence, (one or one type) human matrix metalloproteinase substrate sequence and human tumor necrosis factor-alpha (TNF-alpha) sequence, and further relates to the expression of these fusion protein genes, engineering bacteria, and fusion proteins in prokaryotic cells Expression, separation and purification of fusion protein, and evidence of targeting and specific killing effects on malignant tumor cells. Background technique [0002] Malignant tumor is one of the most harmful diseases to human health and life. With the rapid development of tumor immunology, molecular biology a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/70C12N15/62
Inventor黄迪南侯敢
OwnerGUANGDONG MEDICAL UNIV