Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for constructing BmNPV- silkworm larvae multiple gene expression system

A construction method and expression system technology, applied in the construction field of BmNPV-bombyx mori larvae multi-gene expression system, can solve the problems of small amount of VLPs assembly, cumbersome operation, and difficulty in ensuring simultaneous entry of multiple baculoviruses

Inactive Publication Date: 2009-02-25
NANYANG NORMAL UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the BmNPV-bombyx mori larvae expression system also has its disadvantages: due to the size limitation of the transfer vector, a donor plasmid can only carry four exogenous gene expression cassettes at most, which is useful for the simultaneous expression of multiple exogenous genes using the BmNPV-bombyx mori larvae expression system. great limitations
Another method is to simultaneously clone multiple target genes into the NPV genome through a donor plasmid carrying multiple promoters. Only one recombinant baculovirus is needed to infect insect cells to express several target proteins, and then assemble Formation of VLPs. In the early days, the previous method was the main method. This method is cumbersome to operate and requires the construction of several recombinant baculoviruses. During the infection process, it is difficult to ensure that multiple baculoviruses enter each cell at the same time, which may cause VLPs assembly. less amount
With the development of recombinant baculovirus technology, especially the emergence of multiple (2-4) expression cassettes at the same time, the latter technology is currently used to obtain VLPs. The operation is relatively simple and the output of VLPs is high, but Due to the limitations of the BmNPV-bombyx mori larvae expression system in the expression of multiple genes, the widespread utilization of its production of VLPs is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing BmNPV- silkworm larvae multiple gene expression system
  • Method for constructing BmNPV- silkworm larvae multiple gene expression system
  • Method for constructing BmNPV- silkworm larvae multiple gene expression system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Embodiment 1: the method for constructing baculovirus-bombyx mori larvae multigene expression system

[0015] (1) Construction of donor plasmid

[0016] Such as figure 1 As shown, the cis-activating element oriT is derived from factor F and is responsible for the transfer of the donor plasmid. The specific construction process is as follows: Zeocin resistance gene (Em7-ZeoR) was amplified by PCR, and two homology arm sequences (HL and HR), two I-SceI sites, and BstBI were added to its two segments respectively , SacI, pmeI, AvrII and other enzyme cutting sites. The upstream and downstream primers are: ZeoR-F: 5'-TTCGAATA GGGATAACAGGGTAATACGCATCACTTACAACAGGGGGGACTATGAAATTATGCATTTGAGGATGCAGCACGTGTTGACAA-3'; ZeoR-R: 5'-GAGCTCTAGGGATAACAGGGTAATAAATGCAAATGTATTGTTATAGTATAATCCCTAATAATTTCATTGGATTGAACCCTA. The PCR product was first cloned into a T vector to obtain recombinant pSimple-Em7zeo, and then NcoI / SalI double enzyme digestion removed the Zeocin coding region and retai...

Embodiment 2

[0026] Example 2: Construction and expression of recombinant viruses carrying dual fluorescent reporter genes

[0027] (1) Construction of recombinant donor plasmid

[0028] The donor vector pHTdual was obtained according to the preparation method in (1) of Example 1, pDsRed2-1 was digested with BamHI / NotI, the red fluorescent protein gene DsRed fragment was recovered, and cloned into the vector pHTdual to obtain the recombinant plasmid pHTdual-DsRed. The pIRES-gfp was digested with SmaI / XhoI, and the gfp fragment of the green fluorescent protein gene was recovered, and cloned into the vector pUCDM to obtain the recombinant plasmid pUCDM-gfp.

[0029] (2) the construction of recipient bacterium recipient bacterium I-SceI DH10B; (3) the transformation of acceptor BmBacmid; (4) obtain recombinant BmBacmid; (5) the method that recombinant virus produces is according to (2) in embodiment 1 respectively , (3), (4), (5) steps are made.

[0030] (6) Expression of recombinant virus ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing a BmNPV-domestic silkworm larva polygene expression system, which comprises the following steps: (1) an I-SceI expression cassette controlled by arabinose promoter (pBAD) is recombined into the genome of E.coli D H10B to obtain new recipient bacteria I-SceI DH10B; (2) a donor plasmid used for combined transformation is constructed; (3) a recombination site of cre / loxp replaces v-cath gene and chitin gene in the BmBacmid genome, and two I-SceI sites replace p70 gene in the BmBacmid to obtain a receptor I-sceI BmMultibac; (4) an exogenous gene is induced by the three methods of cre-loxp recombination, Tn7 recombination and combined transformation; (5) a recombined Bacmid DNA is prepared by a conventional method, and is used for transfecting insect cells or injected into the silkworm larva. The BmNPV-domestic silkworm larva polygene expression system lays a foundation for studying multimeric proteins, the interaction between proteins and preparing virus-like particles.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and protein engineering, and in particular relates to a method for constructing a BmNPV-bombyx mori larvae multigene expression system. Background technique [0002] Because it is safe for humans and mammals, the super-strong polyhedron promoter (polh) drives the high-efficiency expression of foreign genes in insect cells, the insect cell culture is convenient, the virus operation is simple, and the ability to clone foreign fragments is large (30-50kb) , The expression product has the characteristics of correct post-processing, etc., and the Baculovirus Expression System (BES, Baculovirus Expresson System) has become one of the excellent expression systems for expressing eukaryotic genes. At present, the sources of exogenous genes expressed by the baculovirus expression system are found in various organisms such as viruses, bacteria, fungi, animals and plants, and its application scope involves...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/866
Inventor 姚伦广张二辉孙京臣阚云超刘宗才刘飞
Owner NANYANG NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More