Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Composition of bFGF modified liposome and shRNA expression vector targeting human VEGF gene and preparation method thereof

A technology of liposome complexes and expression vectors, which can be used in liposome delivery, gene therapy, non-effective ingredients of polymer compounds, etc., and can solve the problems of high siRNA operation requirements, large siRNA dosage, and short action time. To achieve the effect of reducing drug dosage, good targeting effect, and long-lasting effect

Inactive Publication Date: 2009-03-11
SICHUAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the current literature reports use chemically synthesized siRNA to treat tumors, and chemically synthesized siRNA has the following disadvantages: chemically synthesized siRNA consumes a large amount and costs high; short

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition of bFGF modified liposome and shRNA expression vector targeting human VEGF gene and preparation method thereof
  • Composition of bFGF modified liposome and shRNA expression vector targeting human VEGF gene and preparation method thereof
  • Composition of bFGF modified liposome and shRNA expression vector targeting human VEGF gene and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of shRNA expression plasmid targeting VEGF gene

[0028] According to literature reports, the siRNA sequence with the strongest inhibition of VEGF gene expression is VEGF-328:

[0029] 5'-ACCTCACCAAGGCCAGCAC-3'(21nt) (position 328-348bp in the coding region of human VEGF gene): (humanVEGF: GenBank accession no: NM_001025366), the shRNA plasmid expression vector is constructed as follows:

[0030] 1. Synthesize the following primer sequences:

[0031] RNA interference target sequence of VEGF-328 (SEQ ID NO.1): 5'-AAACCTCACCAAGGCCAGCAC-3'

[0032] Primer structure:

[0033] +Sense+Loop+Antisense+termination signal+SacI+

[0034] Primer sense strand (SEQ ID NO.2):

[0035] 5'- ACCTCACCAAGGCCAGCAC TTCAAGACGGTGCTGGCCTTGGTGAGGTTTTTTTTGAGCTC -3'

[0036] (designed with SacI restriction site)

[0037] Primer antisense strand (SEQ ID NO.3):

[0038] 5'-AGCTTGAGCTCAAAAAAACCTCACCAAGGCCAGCACCGTCTTGAAGTGCTGGCCTTGGTGAGGTG-3'

[0039] 2. Ligate...

Embodiment 2

[0064] The preparation of the cationic liposome complex of embodiment two plasmid DNA-bFGF mutant modification

[0065] 1. Preparation of cationic liposomes modified by bFGF mutants

[0066] The cationic liposome DOTAP was mixed with the neutral component cholesterol (Chol) at a molar ratio of 1:1, and the mixture was dissolved with HPLC grade chloroform, and placed on a rotary evaporator at 40°C for 1 hour. Form a film and dry overnight in vacuum. The formed film was taken out and dissolved in 5% glucose solution, then shaken in a water bath at 55°C for 1 hour, transferred the mixture to a test tube, and squeezed 4 times through a 220nm polycarbonate film, and finally dissolved the mixture In an appropriate amount of 5% glucose solution, a 5 mg / ml DOTAP-Chol cationic liposome suspension was obtained. According to cationic liposome:bFGF mutant=2:1 (mass ratio), slowly add bFGF mutant protein in liposome solution, hatch at 4 degrees centigrade and form the cationic liposome m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of tumor gene therapy, and more particularly relates to a compound formed by RNA interference expression plasmid of targeted human VEGF genes and a cationic liposome modified by bFGF, and a preparation method and the use thereof. The first technical problem solved by the invention is that a gene therapy product with anti-tumor function is provided. The technical proposal for solving the problem is that a liposome compound is provided. The liposome compound takes liposome compounded by DOTAP, cholesterol and bFGF as an encapsulating layer with the following mixture ratio: the mol ratio of the DOTAP and the cholesterol is 2:1-2, and the weight of the tbFGF polypeptide is 20-80% of the total weight of the DOTAP and the cholesterol; and the encapsulating can express the compound formed by the expression vector of RNA interference sequence of human VEGF genes in human body. The compound has protective and slow release functions and good targeting effect on shRNA plasmid.

Description

technical field [0001] The invention belongs to the field of tumor gene therapy, and specifically relates to a complex formed by an RNA interference expression plasmid targeting human VEGF gene and a cationic liposome modified by bFGF, its preparation method, and preparation of anti-tumor drugs and anti-tumor auxiliary drugs use in . Background technique [0002] Tumor growth is inseparable from angiogenesis. When the tumor diameter exceeds 2-3mm, the growth of the tumor depends on various pro-angiogenic factors secreted by tumor cells to induce angiogenesis, thereby supporting the further growth and metastasis of the tumor. In the process of promoting tumor angiogenesis, vascular endothelial growth factor (VEGF, VEGF) is one of the strongest stimulating factors. A large number of studies have found that the expression of VEGF gene in various tumor tissues is significantly higher than that in normal tissues. , such as lung cancer, liver cancer, colon cancer, prostate cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/127A61K31/711A61K48/00A61K47/42A61P35/00
Inventor 魏于全邓洪新陈俐娟杨莉
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com