Unlock instant, AI-driven research and patent intelligence for your innovation.

Subtype H5 avian influenza virus detection kit and use thereof

An avian influenza virus and kit technology, which is applied in the field of H5 subtype avian influenza virus detection kits, can solve the problems of complicated process, time-consuming and only detection, and achieves the effects of high sensitivity, simple and convenient operation, and high specificity.

Inactive Publication Date: 2009-03-11
CHINA AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Etiological diagnosis methods include animal inoculation tests and cell culture methods, which are complex and time-consuming
Serological diagnostic methods include agar diffusion (AGP) test, hemagglutination test, hemagglutination inhibition (HI) test, neuraminidase inhibition (NI) test, enzyme-linked immunosorbent assay (ELISA), virus neutralization test (SN) And immunofluorescence (IF), etc., the shortcoming of serological diagnosis method is that it can only detect the antibody of bird flu virus in the animal body but cannot detect the pathogen
Molecular biology diagnostic methods include PCR, nucleic acid probe technology, etc., which are faster and more sensitive than the first two methods, but require the use of special instruments (such as PCR machines), and the preparation of fluorescent probes is relatively expensive, which is not suitable for grassroots applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Subtype H5 avian influenza virus detection kit and use thereof
  • Subtype H5 avian influenza virus detection kit and use thereof
  • Subtype H5 avian influenza virus detection kit and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, the preparation of H5 subtype avian influenza virus detection kit

[0058] 1. Synthesis of primers

[0059] Artificially synthesize the following 3 pairs of primers:

[0060] F3: GTGAATTGGAATATGGTAACTGC;

[0061] B3: CCATTCCCTGCCATCCTC;

[0062] FIP: CGATGGTGAGAGGGTGTATGTTTTAAACTCCAATGGGGGCG;

[0063] BIP: CTTGCGACAGGGCTCAGAAATTTTCTGCTATAGCTCCAAATAGTCC;

[0064] LF: TGTGGAATGGCATACTAGAGTT;

[0065] LB: AGCCCTCAAGGAGAGAGA.

[0066] 2. Preparation of LAMP reaction solution

[0067] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.04 μmol upstream inner primer (FIP), 0.04 μmol downstream inner primer (BIP), 0.004 μmol upstream outer primer (F3), 0.004 μmol Downstream outer primer (B3), 0.02 μmol upstream circular primer (LF), 0.02 μmol downstream circu...

Embodiment 2

[0070] Embodiment 2, the preparation of H5N1 subtype avian influenza virus detection kit

[0071] 1. Synthesis of primers

[0072] Same as Step 1 of Example 1.

[0073] 2. Preparation of LAMP reaction solution

[0074] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.06 μmol upstream inner primer (FIP), 0.06 μmol downstream inner primer (BIP), 0.008 μmol upstream outer primer (F3), 0.008 μmol Downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.

[0075] 3. Assembly of kit

[0076] Same as Step 3 of Example 1.

Embodiment 3

[0077] Embodiment 3, the preparation of H5 subtype avian influenza virus detection kit

[0078] 1. Synthesis of primers

[0079] Same as Step 1 of Example 1.

[0080] 2. Preparation of LAMP reaction solution

[0081] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.05 μmol upstream inner primer (FIP), 0.05 μmol downstream inner primer (BIP), 0.006 μmol upstream outer primer (F3), 0.006 μmol Downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.

[0082] 3. Assembly of kit

[0083] Same as Step 3 of Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an H5 subtype bird flu virus detection reagent kit and application thereof. The reagent kit provided by the invention comprises three pairs of primers, namely an inner side primer pair, an outer side primer pair and an annular primer pair combined with bird flu H5N1 virus HA genes. The reagent kit also comprises a loop-mediated isothermal amplification reagent, positive contrast, negative contrast and a fluorescent chromogenic reagent; and the positive contrast is an H5 subtype bird flu virus RNA. The invention also provides a method for detecting whether the H5 subtype bird flu virus is carried in animals by applying the reagent kit. The H5 subtype bird flu virus detection reagent kit has high detection sensitivity, can detect a target RNA with 6 to 10 copies, is simple and convenient to operate and is particularly suitable for pathogenic detection carried out in the grass-roots field and the detection of the H5 subtype bird flu virus possibly polluting animal food.

Description

technical field [0001] The invention relates to a detection kit for H5 subtype avian influenza virus and its application. Background technique [0002] Avian influenza viruses belong to the Orthomyxoviridae family Influenzavirus type A influenza virus. Avian influenza is an infectious disease characterized by respiratory system and systemic sepsis caused by avian influenza virus infecting poultry. Since December 2003, large-scale avian influenza outbreaks (all of which are highly pathogenic avian influenza H5N1) have broken out in Asian countries such as Vietnam, South Korea, and Japan, which not only caused huge economic losses to the poultry industry in the world, but also brought great harm to human beings. Health and life safety pose a serious threat. According to the statistics of the World Health Organization, as of May 31, 2007, 309 cases of bird flu infection have been confirmed worldwide, and 187 cases have died. [0003] There are many methods for detecting H5 s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 吴文学黄书林
Owner CHINA AGRI UNIV