Paulownia 4-coumaric acid: coenzyme A ligase gene and use thereof
A technology of coumaric acid and ligase, applied in the field of bioengineering, can solve problems such as low strength and hardness, limited application, and low bulk density
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Cloning and sequencing of Paulownia part 4CL coding sequence:
[0029] 1. Design of degenerate primers: The amino acid homology of plant 4-coumaric acid: Coenzyme A ligase protein was analyzed by GenBanK BLAST system, and its completely homologous part was selected, and 2 pairs of degenerate primers were selected, listed below All PCR primers involved in the present invention have been described.
[0030] (1) Degenerate primers:
[0031] B4F7 5'-CACARCARGTHGAYGGHGAVAAYCC-3'
[0032] B4R7 5'-CCWGCYTCDGTCATBCCRTADCCCTG-3'
[0033] B4F8 5'-CACARCARGTHGAYGGHGAVAAYCC-3'
[0034] B4R8 5'-CKRATGCARATYTCWCCRGSRTGRTT-3'
[0035] (2) 5' RACE primer:
[0036] Outer Primer 5'-catggctacatgctgacagccta-3'
[0037] Inner Primer 5'-cgcggatccacagcctactgatgatcagtcgatg-3'
[0038] 4.5GSP1 5'CAAAACAATCGGCGGCACGAAGGGC 3'
[0039] 4.5GSP2 5'AACGGAACAATATCGAATTTCTGCATGATCAGG 3'
[0040] (3) 3'RACE Primer 3'RACE:
[0041] Outer Primer 5'-TACCGTCGTTCCACTAGTGATTT-3'
[0042]...
Embodiment 2
[0080] Example 2: Acquisition of unknown sequence upstream of Paulownia 4CL mRNA 5':
[0081] A preferred solution is to use the 5'-FULL RACE kit (Code No: D315) produced by TaKaRa Company. The first step of this technical system is phosphorylation, the second step is to remove the cap, and the third step is to add a linker. Theoretically speaking, the first step eliminates all those that have lost their "caps", broken in the middle, and incomplete. Incomplete and incomplete mRNA, so that the unknown 5' end of the clone is complete, and the cloned mRNA may be full-length. At the same time, technologies such as adding specific adapters and nested PCR are used to amplify the full-length sequence of the 5' end of cDNA with high sensitivity and high specificity.
[0082] The partial coding sequence of Paulownia 4CL was obtained by RT-PCR with the obtained degenerate primers, and 2 specific nested PCR primers were optimized, as shown in 1 of Example 1 (design of degenerate primers...
Embodiment 3
[0085] Example 3: Acquisition of Unknown Sequence Downstream of Paulownia 4CL mRNA 3':
[0086]A preferred solution is to use 3'-FULL RACE Core Set Ver.20 (Code No: D314) produced by TaKaRa Company. This technology system uses technologies such as Oligad (T) adapters and primers added with specific sequences, so that the 3' end sequence of cDNA can be amplified more sensitively and specifically through the known partial cDNA sequence.
[0087] The partial coding sequence of Paulownia 4CL was obtained by RT-PCR with the obtained degenerate primers, and 2 specific nested PCR primers were optimized, as shown in 1 of Example 1 (design of degenerate primers).
[0088] Concrete cloning procedures include: a. Extraction of total RNA of Paulownia: the same as 2 in Example 1 (extraction of total RNA of Paulownia); b. Nested PCR reaction: the specific primer GSP1 and 3' RACE Outer Primer [ See 1 in Example 1 (design of degenerate primers)], carry out PCR reaction, and then use the inte...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com