Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine
A technology of F427N, anthrax toxin, applied in the direction of microorganism-based methods, antibacterial drugs, microorganisms, etc., to achieve the effect of good immunogenicity and high biological safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Cloning of the target gene
[0040] (1) Cloning of Bacillus anthracis protective antigen PA gene
[0041] 1. PCR primer design and synthesis
[0042] The upstream and downstream primers were designed according to the PA gene sequence reported in Genbank (Genbank accession number: No.AF065404). The upstream primer introduces the BamHI restriction site (as indicated by the underline in the primer), and designs 4 protective bases ACTA, and the downstream primer introduces the XhoI restriction site (as indicated by the underline in the primer), plus 4 protective bases GTAT. The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. The sequence of the primer pair is as follows:
[0043] PA upstream primer: 5'-ACTA GGATCC GAAGTTAAACAGGAGAACC-3'
[0044] PA downstream primer: 5'GTAT CTCGAG CTATTATCCTATCTCATAGCCT-3'
[0045] 2. PA protein coding gene amplification and processing
[0046] Acapsulated anthrax...
Embodiment 2
[0059] Example 2 Site-directed saturation mutation of the 427th amino acid of the protective antigen PA and cloning of the mutant
[0060]1. Site-directed saturation mutation of phenylalanine at position 427 of the Bacillus anthracis protective antigen PA gene into 19 other naturally occurring amino acids
[0061] (1) PCR primer design and synthesis
[0062] According to the PA gene sequence in Genbank (Genbank accession number: No.AF065404), the upstream and downstream primers for site-directed saturation mutation of amino acid 427 of PA were designed. In the upstream and downstream primers, the codon TTC of phenylalanine was designed as a randomly synthesized base NNN (as indicated by the underline in the primer). The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. F427N upstream primer: 5`-CGCATTAAATGCACAAGACGAT NNN AGTTCTACTCC-3`; (N = A, T GC)
[0063] F427N downstream primer: 5`CATTGTAATTGGAGTAGAACT NNN ATCG...
Embodiment 3
[0068] Example 3 Expression and purification of protein
[0069] (1) Cloning of Bacillus anthracis protective antigen PA gene and preparation method for expression and purification in recombinant Escherichia coli
[0070] 1. Construction of recombinant Escherichia coli BL21 / pGEX-KG-PA
[0071] Transform the recombinant expression vector pGEX-KG-PA with correct sequence identification into CaCl 2 Coli BL21 (DE3) (preserved by our laboratory) competent cells prepared by the method were spread on a plate, and a single positive colony (BL21 / pGEX-KG-PA) on the plate was selected and inserted into LB liquid medium for shaking culture at 37°C until (OD 600 =1.0), adding isopropylthio-β-D-galactoside (IPTG) to the medium to induce expression, and then carried out SDS-PAGE and Western-blot detection (Sambrook J, Fritsch EF, Mann Edited by Niartis T, Molecular Cloning Experiment Guide, translated by Jin Dongyan, Li Mengfeng, etc., second edition, Science Press, Beijing, 1992 edition)...
PUM
Property | Measurement | Unit |
---|---|---|
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap