Improved method of determining chemical
A technology for chemical substances and substrates, applied in the field of transformed cells and devices used in the method, can solve problems such as unsolvable, expensive animal experiments, and unsuccessful implementation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The following experiments were performed to check which yeast genes are suitable for detecting toxic substances.
[0069] Yeast (Saccharomyces cerevisiae S288C(α SUC2mal mel gap2CUP1)) was cultured on a YPD medium (yeast extract 1%, polypeptone 2%, glucose 2%) at 25°C. One of the toxic chemicals was added to the cells in logarithmic growth phase and the cells were incubated for an additional 2 hours. Cells were cultured under the same conditions without any chemical substances, which were used as controls. The concentration of the chemical was limited to inhibit yeast growth but not cause death.
[0070]
[0071]
[0072] 1) 41.0% N-(phosphonic acid methyl) ammonium glycinate, 59.0% surfactant
[0073] After the culture was completed, the culture was centrifuged to collect the cells. Sodium acetate buffer (50 mM sodium acetate, 10 mM EDTA, 1% SDS) was added to these cells, and the mixture was shaken at 65°C for 5 minutes and then returned to room temperature to...
Embodiment 2
[0161] Primers for PCR for amplifying a polynucleotide comprising a promoter of yeast gene YKL071w by PCR were prepared. Primers were designed using primer design software (Oligo4.0-S, Sequencher I Mackintosh version). The base sequence of the upstream primer is:
[0162] cgcaataatactggaaacatcaa (serial number: 2),
[0163] And the base sequence of the downstream primer is:
[0164] atcgactttgtttgcttagaat (serial number: 3).
[0165] For PCR, yeast chromosome (Saccharomyces cerevisiae S288C, Cat. 40802, Research Genetics, Inc.) was used as a template, and a commercial kit (KODDNA Polymerase; No. KOD-101, Toyobo) was used as a reagent.
[0166] The YEp-type shuttle vector pYES2 (pYES2, Cat no: V825-20, Invirtogen Corporation, USA) capable of replicating in Escherichia coli and yeast was used as a vector (R.W.Old, S.B. Primrose Principles of Gene Manipulation 5th Ed., BAIFUKANCO., LTD, pp138-165, pp.234-263, 2000). A portion of the vector pQBI 63 (Cat no. 54-008...
Embodiment 3
[0179] The transformed yeast produced in Example 2 was grown to a steady state by shaking culture in SD medium (adenine, histidine, tryptophan, leucine) at 25°C.
[0180] The steady-state yeast was diluted 500-fold with SD medium, and cultured with shaking at 25°C for 15 hours. After confirming the logarithmic growth phase with absorbance at 600 nm of 0.2-0.5, different concentrations of TPN were added. Solutions containing final concentrations of 0.0053 ppm, 0.053 ppm and 0.53 ppm were defined as solutions A, B and C, respectively.
[0181] In addition, as a reference solution, a solution without TPN was defined as standard solution S.
[0182] Put sample solution A, B or C into figure 2 The chemical species measurement system shown in the block diagram is placed in the first cell, and then starts measuring the amount of dissolved oxygen.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More