Method for producing human amyloid A<beta>1-42 with methylotrophy yeast

A methylotrophic yeast, using methyl technology, applied in the field of protein production, purification and identification, to achieve the effect of simple medium composition, low production cost and high expression

Inactive Publication Date: 2009-07-29
吉林圣元科技有限责任公司
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date, no information on the production of human Aβ using Pichia pastoris 1-42 report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing human amyloid A&lt;beta&gt;1-42 with methylotrophy yeast
  • Method for producing human amyloid A&lt;beta&gt;1-42 with methylotrophy yeast
  • Method for producing human amyloid A&lt;beta&gt;1-42 with methylotrophy yeast

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Human amyloid Aβ 1-42 Gene Acquisition and Amplification

[0042] (1) Human amyloid Aβ 1-42 Preparation of DNA:

[0043] A synthetic approach will encode human Aβ 1-42 The genetic codons of amino acids were all replaced with yeast preferred codons, and the specific sequence was as follows: 5'-GATGCTGAATTTAGACATGATTCTGGTTACGAAGTTCATCATCAGAAGTTGGTCTTCTTTGCTGAAGATGTTGGTTCTAACAAGGGTGCTATTATTGGTTTGATGGTTGGTGGTGTTGTTATTGCT-3' (SEQ ID NO.1).

[0044] Take the above DNA, and set up 50 μl of PCR reaction system according to the following ratio:

[0045] Take the human Aβ synthesized above 1-42 DNA as template 1μl (2pmol / μl); containing Mg 2+ 5 μl of 10×PCR buffer; 2.5 μl of dNTPs (each 2.5 mmol / L); the partial sequence of the yeast α factor signal peptide was introduced at the 5' end, and the upstream primer: 5'-CGCCTCGAGAAGAGAGATGCTGAATTTAG-3' (SEQ ID NO.2) 1μl (20pmol / μl) contains XhoI restriction site; downstream primer: 5'-CCACAACAATAACGAATTCTTAAGCGCGC-3' (S...

Embodiment 2

[0052] Example 2: pPICZα-hAβ 1-42 Transformation of Pichia pastoris X-33

[0053] Take the culture medium with correct sequencing, extract the plasmid DNA according to the instructions of the plasmid extraction kit, and perform quantitative analysis by agarose gel electrophoresis. Take 20~25μg pPICZα-hAβ 1-42, The recombinant plasmid was digested with SacI (linearized), extracted with phenol / chloroform and precipitated with ethanol. The linearized plasmid was dissolved in 10 μl ultrapure water and kept on ice for later use.

[0054] Pick a single colony from the YPD negative culture plate of Pichia pastoris X-33 (YPD agar plate without antibiotics), inoculate it in 5ml of YPD medium, shake it at 250rpm, 30°C for 8 hours, and prepare yeast for electroporation competent cells.

[0055] Then take 80 μl of the above-mentioned competent bacteria, mix them with 20-25 μg of linearized recombinant expression plasmids, transfer them into a 0.2 cm electroporation cup for electropora...

Embodiment 3

[0057] Embodiment 3: recombinant human amyloid Aβ 1-42 expression

[0058] Inoculate the positive clones of the above identification results in 10ml of BMGY (pH6.0) medium, culture with shaking at 30°C for 24 hours, until OD 600 Cells were collected when reaching 2.0-6.0. Resuspend the cell pellet with an equal volume (10ml) of BMMY (pH6.0), culture with shaking at 30°C, and induce expression. During the induction process, methanol was supplemented every 24 hours to a final concentration of 0.5%, and sterilized ultrapure water was supplemented at the same time to keep the total volume of the fermentation broth unchanged. At 0, 24, 48, 72, 96, 120, 144 and 168 hours of culture, 0.5 ml of fermentation broth was taken respectively, and the supernatant was collected by centrifugation for protein analysis (SDS-PAGE, Western Blot).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for producing, purifying and appraising protein, in particular to a method for expression of recombinant human Abeta1-42 in Pasteur yeast as well as optimized large scale industrialized fermentation production and purification of the recombinant human Abeta1-42.

Description

field of invention [0001] The present invention relates to protein production, purification and identification methods, in particular to expression of recombinant human amyloid protein (β-amyloid protein, Aβ) in Pasteur yeast 1-42 ), and optimized large-scale industrial fermentation to produce recombinant human amyloid Aβ 1-42 Methods. Background of the invention [0002] Alzheimer's disease (AD), first proposed by German scholar Alosi Alzheimer in 1907, has received more and more attention. The main pathological features of AD are the formation of extracellular senile plaques and the accumulation of intracellular neurofibrillary tangles. Although the pathogenesis of AD is still unclear, it is generally believed that the main component of senile plaques, Aβ 1-42 It is neuronal toxic and is the main cause of AD. Aβ is produced by cleavage of its precursor - amyloid precursor protein (APP). APP is a transmembrane polypeptide consisting of 770 amino acids with a short half...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/81C12N1/19C07K14/47C12R1/84
Inventor颜炜群申茉函
Owner吉林圣元科技有限责任公司