Anther tapetum and pollen specific efficient promoter as well as application thereof
An anther tapetum and promoter technology, applied in the biological field, can solve the problems of long period of male sterility type, single source of sterility gene, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1. Cloning of maize anther tapetum and pollen-specific promoter sequence pZm401
[0035] The cDNA clone Zm401 (682bp) (Li et al., 2001), which was isolated from the mature pollen cDNA library of maize and obtained pollen-specific expression (Li et al., 2001), was used as a probe (its nucleotide sequence is shown in SEQ ID No.2) to screen the maize genome Library (Cat. #FL1032D, Lot #5443, Clontech, Palo Alto, CA, USA), a genomic clone pGZM401 of the Zm401 gene was obtained. Sequence analysis The total length of the genomic DNA is 6.0kb, of which the 5' end 1-2000 (base position at the beginning of the sequence is 1) is the deduced promoter segment, which has the cis-acting element TATAbox bound by RNA polymerase II (1844-1849) and CAAT box (1720-1723), in addition to the pollen-specific cis-element GC box (1496-1500), the 6bp Q factor (NTP303Qelement, AAATGA, No.801- 806 and LAT52 Q element, TGGTTA, No. 1266-1271) ( figure 1 ).
Embodiment 2
[0036] Example 2. Isolation of maize anther tapetum and pollen-specific promoter sequence pZm401
[0037] The following two primers were designed and synthesized, and a restriction endonuclease HindIII site and a restriction endonuclease XbaI site were respectively added to the 5' ends of the two primers for the needs of separation and construction in the future:
[0038] Primer 1: 5'CC AAGCTT CTGCAGACATAGCTCTCGAC3'
[0039] Primer 2: 5'CATCAAACACTTGGCCTATTACTAGCC3'
[0040] Using the plasmid DNA pGZM401 as a template, carry out PCR reaction, the reaction system is as follows:
[0041] Reaction component Addition amount
[0042] Buffer (10X) (containing 20mmol / LMgCl 2 ) 2.5 μl
[0043] dNTP (10mmol / L) 0.5μl
[0044] Primer 1 (10μmol / L) 0.5μl
[0045] Primer 2 (10μmol / L) 0.5μl
[0046] Taq (2.5u / μl) 0.5μl
[0047] h 2 O 19.5 μl
[0048] Template plasmid (0.2μg / μl) 0.5μl
[0049] Total volume 25.0μl
[0050] Amplification conditions: 95°C for 10 min; 95°C for 1 min...
Embodiment 3
[0051] Example 3. Construction of plant expression vector pZm401::GUS
[0052] as attached figure 2 As shown, the p401pro3Z plasmid was extracted by alkaline lysis, digested with SalI, filled in with Klenow, and then digested with XbaI to obtain the pZm401 promoter fragment, which was expressed in plants that had been digested with HindIII, filled in with Klenow, and digested with XbaI. The large fragments of the vector pBI121 (ClonTech) were ligated, and then the ligated product was transformed into 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( The LB liquid culture medium of final concentration 100 μ g / ml) is cultivated overnight, and centrifugation collects thalline and extracts plasmid by alkaline lysis method, is identified correctly through restriction endonuclease digestion and PCR ( imag...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 