Gene deletion system for security control of transgene monocotyledon

A monocotyledon, gene deletion technology, applied in the field of high-efficiency gene deletion system, can solve the problems of exogenous gene escape, poor operability, and low efficiency of exogenous gene

Inactive Publication Date: 2010-01-13
SOUTHWEST UNIVERSITY
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] ①At present, these technologies are mainly concerned with removing reporter genes (such as GUS gene or GFP gene) or resistance marker genes (such as NPTII gene or Bar gene, etc.) in transgenic plants, while improving crop quality, increasing crop yield and Exogenous target genes such as improving crop resistance have not been deleted from transgenic plants after completing their functions. These exogenous genes may still escape into nature and pose a threat to the ecological environment and human health. Food safety concerns will also remain
② The efficiency of the above-mentioned technologies to delete foreign genes in transgenic plants is relatively low, and can only delete foreign genes in transgenic plants to a certain extent, and cannot meet the requirements for efficient deletion of transgenes after large-scale release of transgenic crops in the field, and cannot completely solve the problem of transgenic plants. Biosafety issues in
③In addition, these technologies often need to use methods such as hybridization or secondary transformation to delete foreign genes in transgenic plants and obtain plants without foreign genes. The process cycle is too long and the operability is poor
However, in previous reports, the recombinase gene of the "Gene-deletor" system was controlled by the pollen-specific promoter BGP (Xu, H, Davies, S.P., Kwan, B.Y., O'Brien, A.P, Singh, M. & Knox, R.B. Haploid anddiploid expression of a Brassica campestris anther-specific gene promoter in Arabidopsis and tobacco.Mol.Gen.Genet.1993,239,58-65) control, the promoter is derived from dicotyledonous rapeseed, its expression is limited to mature pollen of rapeseed Among them, it cannot be expressed in monocotyledonous plants, so the previous "Gene-deletor" system can only be used in dicotyledonous plants, and the deletion efficiency in monocotyledonous plants has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene deletion system for security control of transgene monocotyledon
  • Gene deletion system for security control of transgene monocotyledon
  • Gene deletion system for security control of transgene monocotyledon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] [Example 1] Construction of plant expression vector

[0047] 1. Cloning of maize pollen-specific promoter ZM13

[0048] According to the report of Hamilton et al. (Hamilton D.A.et al, Sex.Plant Reprod.1989, 2, 208-212), two pairs of primers were synthesized respectively. The upstream primers were: 5'>GCGGTACCCCACTTCGCGGATTC CACGTCTGCAGTATGGTACCAACGGCGGC CC<3' (PstI), the pollen-specific promoter ZM13 was amplified by PCR from the maize (Zea mays) genome.

[0049] React component:

[0050] Genomic DNA (25ng / μL) 2 microliters

[0051] dNTP (10mM each) 2 microliters

[0052] Magnesium chloride (5mM) + 10 times buffer 2 microliters

[0053] Upstream primer, downstream primer (each 100μM) 2 microliters

[0054] Platimum Pfx DNA Polymerase 2U

[0055] DNA polymerase 10x buffer 5 μl

[0056] Total reaction volume 50 μl

[0057] Reaction parameters: 95°C, 5 minutes. 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute, 35 cycles. Extend at 72°C for 10 min.

[0...

Embodiment 2

[0079] [Example 2] Obtaining of transgenic corn plants

[0080] genetic transformation

[0081] Genetic transformation of maize see Wang et al. ( http: / / www.agron.iastate.edu / ptf / service / biolisticmaize.aspx) method. Take the immature embryos of maize Hi II line (from A188×B73) as explants, soak them in 70% ethanol for 2 min after removing the bract leaves, and then soak them in 0.1% HgCl 2 Disinfect in the solution for 20 minutes, rinse with sterile water 3 times, blot dry the water stains, and inoculate on the induction medium. Add 2mg / L 2,4-D to MS medium to induce embryogenic callus.

[0082] Embryogenic calli at different growth stages were used for transformation. The model of the gene gun is BiolisticPDS-1000 / He Particle Delivery System (Bio-Rad). The bombardment parameters are: the distance between the cleavable disk and the carrier is 2.5cm, the distance between the carrier and the barrier net is 0.8cm, the distance between the barrier net and the target cell is...

Embodiment 3

[0094] [Example 3] Expression Analysis of Exogenous Genes in Transgenic Plants

[0095] 1. Expression analysis of GUS gene in transgenic pLF-ZM13-FLP-Ubi-GN maize

[0096] The pollen-specific promoter ZM13 was selected to control the expression of the site-specific recombinase FLP gene. In theory, in transgenic pLF-ZM13-FLP-Ubi-GN plants, the recombinase FLP gene controlled by the ZM13 promoter should only be expressed in mature pollen Expressed in, delete the foreign gene. Therefore, abundant expression of the GUS reporter gene (controlled by the constitutive promoter Ubi) should be detectable in all tissues before pollen maturation in transgenic plants. In order to detect whether the promoter ZM13 has tissue-specific expression characteristics, T 0 The roots, stems and leaves of the generation plants were stained with GUS tissue, Figure 8 Shown in is the GUS staining results of different tissues of pLF-ZM13-FLP-Ubi-GN transgenic plants. It shows that the exogenous gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene deletion system for the security control of transgene monocotyledon, comprising two homodromous loxP and FRT fused specificity recognition sites loxP-FRT, wherein a section of multiple clone site sequence for inserting a target gene to be led in plant is contained between the two specificity recognition sites. The gene deletion system can completely delete foreign genes in a specific plant organ by a plant expression vector which is formed by leading a monocotyledon tissue-specific promoter sequence, and can achieve the deletion efficiency of 99.8 percent, thereby being used for preparing the safe transgene monocotyledon.

Description

technical field [0001] The present invention relates to a high-efficiency gene deletion system that solves the biological safety of transgenic monocotyledonous plants, in particular, relates to a Cre / loxP site-specific recombinase (Site specific recombinase) based on yeast-derived FLP / FRT and bacteriophage system. [0002] The present invention also relates to a plant expression vector containing the gene deletion system. Background technique [0003] Plant transgenic technology has become an important means to increase crop yield and improve crop quality in the world. Although transgenic plants have brought huge benefits to human beings, due to the short period of development and utilization of this technology, human beings have limited understanding of its biological safety. They have concerns about the safety of transgenic technology, and believe that human beings are still unable to make a correct evaluation of the potential dangers of genetically modified technology. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/82A01H5/00
Inventor罗克明裴炎罗明郑雪莲胥珊
OwnerSOUTHWEST UNIVERSITY