Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for efficiently preparing (S)-styrene glycol from carbonyl reductase recombinant bacterium

A technology of phenylethylene glycol and recombinant bacteria, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as insignificant effects

Active Publication Date: 2010-06-02
JIANGNAN UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Increase the expression of the target protein by constructing genetically engineered bacteria to promote the transformation reaction, but the effect is not significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The acquisition of embodiment 1 scrII gene:

[0047] Taking the scr gene (DQ675534) as the starting sequence, in the genome of Candida parapsilosis ( http: / / www.sanger.ac.uk / cgi-bin / blast / submitblast / c_parapsilosis ) found a homologous sequence scr II, using primers SCR II_F and SCR II_R, using the Candida parapsilosis genome as a template, and using PCR to amplify the scr II gene.

[0048] SCR II_F: 5′-ATC GGATCC ATGGGCGAAATCGAATCTTATTGC-3' (BamH I)

[0049] SCR II_R: 5′-TGACT CTCGAG TGGACAAGTGTAACCACCATC GAC-3′ (Xho I)

[0050] The PCR system is: ddH 2 O 35.5μL, 10×Reaction Buffer 5μL, 25mmol / L Mg 2+ 3 μL, 2.5 mmol / L dNTP 4 μL, Taq DNA Polymerase 0.5 μL, 25 pmol / μL primers SCRII_F and SCR II_R 1 μL each;

[0051] PCR reaction conditions: 94°C for 4min; 30 cycles of 94°C for 1min, 56°C for 1min, 72°C for 1min; 72°C for 10min. The scr II gene was obtained by PCR reaction, GenBank number: GQ411433.

Embodiment 2

[0052] The acquisition of embodiment 2 recombinant plasmid pETSCRII:

[0053] Restriction endonucleases BamHI and XhoI were used to double-enzyme-cut the target gene scr II and the vector pET28a respectively, and after the treatment, the DNA fragments were ligated through cohesive ends to obtain the recombinant plasmid pETSCR II with the scr II gene. Plasmid pETSCR II was extracted using the plasmid extraction kit Mini-Plasmid Rapid Isolation Kit (purchased from Beijing Biotech Co., Ltd.).

Embodiment 3

[0054] Example 3 Obtaining of recombinant strain E.coli BL21 / pETSCRII:

[0055] The recombinant plasmid pETSCR II was transformed into E. coli E. coli BL21 (DE3) competent cells, and the recombinant strain E. coli BL21 / pETSCR II was obtained by screening on LB plates containing 100 μg / mL kanamycin. The recombinant Escherichia coli is sent to the China Center for Type Culture Collection for preservation, and the preservation number is CCTCC NO: M209290.

[0056] Transform Escherichia coli with the recombinant plasmid: Add 10 μL of the ligation product to 100 μL of E.coli BL21 (DE3) competent cell suspension in each tube, mix gently, and then ice-bath for 30 minutes. Transfer to a 42°C water bath and heat shock for 90s. Quickly transfer to an ice bath and cool for 2 min. Add 700 μL LB liquid medium to each tube, and incubate at 37° C. for 1 hour on a shaker at 100 rpm. After culturing, the bacterial solution was centrifuged at 3,000 rpm for 2 minutes, and 600 μL of the supern...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for efficiently preparing (S)-styrene glycol from a carbonyl reductase recombinant bacterium, belonging to the technical field of biocatalysis asymmetric conversion. The invention provides a novel Candidaparapsiospis carbonyl group reductase gene scr II with Genbank sequence number of GQ411433; the scr II is inserted into a vector pET28a to construct a recombinant plasmid pETSCR II which is converted into E.coli BL21(DE3) competent cell; and a recombinant bacterium E.coli BL21 / pETSCR II with the preservation number of CCTCC NO:M209290 can be obtained by the screening of an LB flat plate containing 100 micrograms / ml kanamycin. The (S)-styrene glycol can be prepared by catalyzing 5g / L 2-carbonyl acetophenone obtained by asymmetrically reducing the recombinant bacterium; and the optical purity of products is 100 percent and the yield reaches 98.1 percent. The invention provides a novel functional gene and an effective path for efficiently preparing the (S)-styrene glycol.

Description

technical field [0001] Fishing the new carbonyl reductase gene scr II from the genome of Candida parapsilosis, constructing a recombinant strain through genetic engineering, and using it to efficiently prepare (S)-phenylethylene glycol and its application, which belongs to biocatalytic asymmetry transforming technology fields. Background technique [0002] Optically pure phenylethylene glycol is not only an indispensable and important chiral additive in liquid crystal materials, but also an important intermediate for the preparation of optically active medicines, pesticides and functional materials. meaningful. [0003] The chemical structure of phenyl glycol is: [0004] The preparation method of chiral compound includes chemical resolution method, chromatographic resolution method, liquid membrane resolution method or chiral solid membrane resolution membrane resolution method and biological method. Among them, the biological method has mild reaction conditions, singl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/53C12N15/70C12P7/22C12R1/19
Inventor 张荣珍徐岩耿亚维
Owner JIANGNAN UNIV