Method for efficiently preparing (S)-styrene glycol from carbonyl reductase recombinant bacterium
A technology of phenylethylene glycol and recombinant bacteria, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as insignificant effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0046] The acquisition of embodiment 1 scrII gene:
[0047] Taking the scr gene (DQ675534) as the starting sequence, in the genome of Candida parapsilosis ( http: / / www.sanger.ac.uk / cgi-bin / blast / submitblast / c_parapsilosis ) found a homologous sequence scr II, using primers SCR II_F and SCR II_R, using the Candida parapsilosis genome as a template, and using PCR to amplify the scr II gene.
[0048] SCR II_F: 5′-ATC GGATCC ATGGGCGAAATCGAATCTTATTGC-3' (BamH I)
[0049] SCR II_R: 5′-TGACT CTCGAG TGGACAAGTGTAACCACCATC GAC-3′ (Xho I)
[0050] The PCR system is: ddH 2 O 35.5μL, 10×Reaction Buffer 5μL, 25mmol / L Mg 2+ 3 μL, 2.5 mmol / L dNTP 4 μL, Taq DNA Polymerase 0.5 μL, 25 pmol / μL primers SCRII_F and SCR II_R 1 μL each;
[0051] PCR reaction conditions: 94°C for 4min; 30 cycles of 94°C for 1min, 56°C for 1min, 72°C for 1min; 72°C for 10min. The scr II gene was obtained by PCR reaction, GenBank number: GQ411433.
Embodiment 2
[0052] The acquisition of embodiment 2 recombinant plasmid pETSCRII:
[0053] Restriction endonucleases BamHI and XhoI were used to double-enzyme-cut the target gene scr II and the vector pET28a respectively, and after the treatment, the DNA fragments were ligated through cohesive ends to obtain the recombinant plasmid pETSCR II with the scr II gene. Plasmid pETSCR II was extracted using the plasmid extraction kit Mini-Plasmid Rapid Isolation Kit (purchased from Beijing Biotech Co., Ltd.).
Embodiment 3
[0054] Example 3 Obtaining of recombinant strain E.coli BL21 / pETSCRII:
[0055] The recombinant plasmid pETSCR II was transformed into E. coli E. coli BL21 (DE3) competent cells, and the recombinant strain E. coli BL21 / pETSCR II was obtained by screening on LB plates containing 100 μg / mL kanamycin. The recombinant Escherichia coli is sent to the China Center for Type Culture Collection for preservation, and the preservation number is CCTCC NO: M209290.
[0056] Transform Escherichia coli with the recombinant plasmid: Add 10 μL of the ligation product to 100 μL of E.coli BL21 (DE3) competent cell suspension in each tube, mix gently, and then ice-bath for 30 minutes. Transfer to a 42°C water bath and heat shock for 90s. Quickly transfer to an ice bath and cool for 2 min. Add 700 μL LB liquid medium to each tube, and incubate at 37° C. for 1 hour on a shaker at 100 rpm. After culturing, the bacterial solution was centrifuged at 3,000 rpm for 2 minutes, and 600 μL of the supern...
PUM
Property | Measurement | Unit |
---|---|---|
optical purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap