Efficient gene knockout method of pseudomonas putida KT2440

A Pseudomonas putida, gene knockout technology, applied in the field of genetic engineering, can solve the problems of difficult high-quantification of vectors, increased cost, labor consumption, etc.

Inactive Publication Date: 2011-05-25
NANJING NORMAL UNIVERSITY
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although this method is effective, multiple steps of cloning and sequencing are time-consuming and labor-intensive, which also increases the cost of the experiment
There are no reports of using this method to knock out large fragments of genes. This method also has the disadvantages of requiring special vectors and difficult high-throughput quantification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient gene knockout method of pseudomonas putida KT2440
  • Efficient gene knockout method of pseudomonas putida KT2440
  • Efficient gene knockout method of pseudomonas putida KT2440

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1. Construction of a plasmid for the expression of recombinase induced by m-toluic acid

[0064] 1. Preparation of Escherichia coli DH10B electroporation competent and DNA transformation

[0065] Inoculate a freshly streaked single colony from the plate into 2ml LB liquid medium 37 o C Shake overnight, transfer to 50 ml LB at 1 / 50 volume, shake culture to the OD of the bacteria 600 About 0.6. Pour the bacterial solution into a pre-cooled centrifuge tube and place in an ice bath for 10 minutes, 4 o C, centrifuge at 5000rpm for 5 minutes, discard the supernatant. Wash the precipitate twice with 10% glycerol, and finally suspend in 200ml of 10% glycerol, and divide into 50ml tubes.

[0066] Add the DNA dissolved in TE buffer or double distilled water to 50ml DH10B electroporation competent cells melted on ice, flick and mix well. The mixture was transferred to a pre-cooled 1mm electroporation cuvette on ice, and transformed by electric shock. Electroporation ...

Embodiment 2

[0085] Example 2. Knockout of 1.0 kb fragment of Pseudomonas putida KT2440 genome PP_3948 gene

[0086] 1. Preparation of Pseudomonas putida KT2440 electroporation competent cells and transformation of pLS512

[0087] from storage at -70 o Streak the Pseudomonas putida KT2440 cryopreservation tube of C into LB solid medium, culture overnight, pick a single colony and put it into 2ml EM liquid medium for 30 o C Shake overnight, transfer to 50 ml EM medium at 1 / 50 volume, and shake to culture the cells to OD 600 About 0.6. Pour the bacterial solution into a pre-cooled centrifuge tube and place in an ice bath for 10 minutes, 4 o C, centrifuge at 7000rpm for 5 minutes, discard the supernatant. The cells were washed 3 times with ice-cold 3 mM 4-hydroxyethylpiperazineethanesulfonic acid (HEPES, pH=7.0), the cells were concentrated 300 times, aliquoted in 50 ml and used for one electrotransformation.

[0088] Transformation of pLS512: Add pLS512 dissolved in TE buffer to 50ml ...

Embodiment 3

[0103] Example 3. Knockout of PP_1384 to PP_1388 7.3kb fragment of Pseudomonas putida KT2440 genome

[0104] The preparation and DNA transformation of the electrotransformation competent cells of Pseudomonas putida KT2440 / pLS512 induced to express the recombinant enzyme were the same as in Example 2.

[0105] Primers were designed to amplify the kanamycin resistance gene containing homologous fragments by PCR. KSD1: 5'-GTCGACGA AGTTGCGGTTGATG, (SEQ ID NO. 13); KSD2: 5'-CCGGTTCGCTTGCTGTC CATATGATCGGCCTTGTTGCAAAAGC, (SEQ ID NO. 14); KSD3: 5'-GCTTTT GCAACAAGGCCGATCATATGGACAGCAAGCGAACCGG, (SEQ ID NO. 15); KSD4: 5'- GAC AAAACAAGGTATTCCCGTGTCAGAAGAACTCGTCAAGAA G, (SEQ ID NO. 16); KSD5: 5'-CTTCTTGACGAGTTTCTTCTGACACGGGAATA CCTTGTTTTGTC, (SEQ ID NO. 17); KSD6: 5'-GCGTGCCGACATTGGGTCG AAC, (SEQ ID NO. 18). There are 43 base pairs of overlap between KSD2 and KSD3 and between KSD4 and KSD5, and they are all presented in the form of reverse complementarity.

[0106] Using the genomic DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for performing gene knockout on pseudomonas putida KT2440 by a recombinant engineering measure. The method comprises the following specific steps of: amplifying through an overlapped-extension polymerase chain reaction so as to obtain a deoxyribonucleic acid (DNA) fragment of which both sides are provided with target genes to be knocked, the upstream and downstream are provided with homologous genes of about 500 base pairs and the middle is provided with a kanamycin resistance gene; electrically transforming the DNA fragment into a pseudomonas putida KT2440 electro-transformation competent cell which is expressed by toluic acid induction recombinase with the final concentration of 2mM; and replacing the target genes by the kanamycin resistance gene through homologous recombination between homologous fragments of a recombinase mediate so as to directly obtain a mutant strain from which target genes are knocked. The method is simple and convenient and can become a genetic operating measure of an environmental microorganism, namely pseudomonas putida KT2440 which has important application value in the aspects of organic compound biodegradation and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for efficiently knocking out the gene of Pseudomonas putida KT2440. Background technique [0002] Pseudomonas putida KT2440 (Pseudomonas putida KT2440) is an important model environmental microbial strain, which is widely used in the research of physiology, ecology, biochemistry, genetics, etc. It is also a good host bacteria for expressing heterologous genes. The genome of Pseudomonas putida KT2440 was analyzed in 2002, and it was also the first Gram-negative strain recognized as environmentally safe by the US Department of Health's Recombinant DNA Committee. Pseudomonas putida KT2440 is the Pseudomonas saprophytica with the most clearly elucidated genetic studies and the most thoroughly studied metabolic diversity so far. It retains the characteristics of survival and function in the environment. , the degradation of biological and non-biological pollutants, and has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C12N15/74C12N15/54C12R1/40
Inventor尚广东杨运文宋杰高九彩
OwnerNANJING NORMAL UNIVERSITY