Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting TP53 gene point mutation and kit for method

A kit and point mutation technology, applied in the field of highly sensitive TP53 gene point mutation detection method and its kit, can solve the problems that Taq enzyme is difficult to combine with inert primers, mutation recognition sequence discrimination, long equipment detection process, etc., to achieve Increase the effect of one-time amplification sites, less instruments, and low cost

Inactive Publication Date: 2013-02-27
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the technology in method (1) is more sensitive than the existing mutation detection method, its required inactive primers are expensive, and the sensitivity is still low. It often takes 40-50 PCR cycles for a single copy of DNA molecules, and this method is not effective for There is a phenomenon of sequence discrimination in mutation recognition, that is, the pyrophosphate hydrolysis activity of Taq enzyme cannot hydrolyze some specific sequences, so it is difficult to bind inert primers, so there is no or little DNA polymerization reaction coupled with them
Although the method (2) has the characteristics of high sensitivity and reliability, the next-generation sequencing technology has yet to mature technically, and it relies on factors such as expensive equipment and a long detection process, which is still limited to experimental research and has not been practical Applied to clinical diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting TP53 gene point mutation and kit for method
  • Method for detecting TP53 gene point mutation and kit for method
  • Method for detecting TP53 gene point mutation and kit for method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Design specific primer pair 1, specific primer pair 2, specific primer pair for TP53 hotspot mutation codon 175 (mutated from CGC to CAC), 248 (mutated from CGG to CAG), and 273 (mutated from CGT to TGT) 3. The details are as shown in the table below, where the bases marked with underline are thio-modified bases:

[0037] Sense primer Antisense primer Specific primer pair 1 ACATGACGGAGGTTGTGAGGCAT TCAGGCGGCTCATAGGGCAC Specific primer pair 2 TCCTGCATGGGCGGCATGAACCAT GGATGTGATGAGAGGTGGATGG Specific primer pair 3 ACGGAACAGCTTTGAGGTGTA AGAGGAGCTGGTGTTGTTGG

[0038] The corresponding PCR product sizes of the specific primer pairs in the above table are 250 bp, 188 bp, and 240 bp, respectively.

Embodiment 2

[0040] A kit for detecting point mutations of TP53 gene, including: 10× Pfu buffer (containing magnesium sulfate MgSO 4 ) 10 μL, dNTP (10 mM each) 2 μL, high-fidelity DNA polymerase (Pfu) 1 μL, specific primer pair 1, specific primer pair 2, and specific primer pair 3 described in Example 1 each 2 μL, of which 1μL of sense primer and antisense primer, 50μL of double distilled water (Milli-Q grade).

Embodiment 3

[0042] A method for detecting point mutations of TP53 gene, the specific detection steps are:

[0043] 1) Take the human lung cancer lesion tissue as the object, extract DNA from the lesion tissue (extract according to the conventional method), a total of 20 specimens;

[0044] 2) Using the kit described in Example 2, combine the three sets of TP53 specific primer pairs corresponding to exon DNA fragments in Example 1 with the obtained DNA, 4 dNTP mixtures, buffers containing magnesium ions, and high security Real DNA polymerase (Pfu) and double distilled water are mixed to form a single PCR reaction system. The PCR reaction system is as follows:

[0045] 10×Pfu buffer (containing MgSO 4 ) 2μL dNTP (each 10 mM) 0.4μL Pfu 0.2μL Sense primer 0.5μL Antisense primer 0.5μL DNA 1μL Double distilled water 15.4μL total capacity 20μL

[0046] Among them, the final concentration of dNTP is 200uM / L, Pfu 1U, the final concentration of each primer is 250pM, and the template DNA conce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene mutation detection, and particularly relates to a TP53 gene point mutation detection method with high sensitivity and a kit for the method. The method comprises the following steps of: 1) extracting DNA according to the conventional technology; 2) then configuring a polymerase chain reaction (PCR) reaction system containing a specific primer pair, DNA polymerase and a PCR conventional component; and 3) performing PCR amplification on the DNA obtained in the step 1), analyzing the PCR product, and judging whether the PCR product has mutation, wherein the last second base of a sense primer in the specific primer pair is a sulfo modified base, and the DNA polymerase is high-fidelity DNA polymerase Pfu. The method has the advantages of rapidity, high specificity, high reliability, sensitivity, low condition dependency, wide application platform and the like.

Description

technical field [0001] The invention belongs to the field of gene mutation detection, and in particular relates to a highly sensitive TP53 gene point mutation detection method and a kit thereof. Background technique [0002] The TP53 gene (gene), discovered in 1979, is one of the genes most strongly associated with tumors so far. The gene is located on chromosome 17, and its protein product has the function of transcription factor. The genes controlled by the TP53 protein are involved in the process of cell division and survival. Like other tumor suppressor genes, the function of the TP53 protein is to prevent uncontrolled cell growth. [0003] The TP53 protein interacts directly with DNA, as well as with other proteins that govern how cells behave. When DNA damage or other cell damage is detected, TP53 immediately initiates the mechanism of apoptosis (apoptosis). The TP53 protein plays a key role in maintaining normal cell regulation, and about half of all tumors, regar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 孙万平王伟大肖莉李凯
Owner SUZHOU UNIV