nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof

A gene knockout, Escherichia coli technology, applied in the application field of sequencing or/and cloning research, to achieve the effect of stable biological traits

Inactive Publication Date: 2013-05-08
ARMY MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no good way to fill this gap in the shotgun sequencing strategy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof
  • nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof
  • nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of linear gene targeting fragments

[0039] (1) Primer design: PCR primers were designed according to the DNA sequence of plasmid pKD3 (SEQ ID NO: 3 in the sequence table), and the base sequence is as follows:

[0040]Linear gene targeting primers (P7, P8):

[0041] P7: 5′ CGTGGAGGCAGTGCATCGACTGTCTGAACAGTATCACCGCTAAG

[0042] GAGTGATTATG GTGTAGGCTGGAGCTGCTTC 3' (underlined is the 55bp upstream homology arm of the nfi gene, including only the start codon of the nfi gene)

[0043] P8: 5′ TTTGTAACATGTTGAGTTTCTCAAATACGGAAATTATCCGCAGTTT

[0044] ACCTGAATTA CATATGAATATCCTCCTTAG 3' (underlined is the 55bp downstream homology arm of the nfi gene, including only the stop codon of the nfi gene)

[0045] Primers P7 and P8 were used to construct linear gene targeting fragments.

[0046] (2) PCR amplification: using the DNA of plasmid pKD3 as a template, PCR was carried out with primers P7 and P8 to amplify the linear gene targeting fragment conta...

Embodiment 2

[0057] Example 2: Construction, screening and identification of Escherichia coli DH5α strain nfi gene knockout mutant

[0058] (1) Preparation of Escherichia coli DH5α Competent Cells by Electroporation

[0059] The recipient bacteria (DH5α) were inoculated in LB medium and cultured with vigorous shaking on a shaker at 37°C until OD600 = 0.5 (about 3 hours); the bacterial solution was quickly placed on ice to cool for 10 minutes, and refrigerated and centrifuged at 3000g for 5 minutes at 4°C ;Discard the supernatant, add 1500μl ice-cold 10% glycerol, use a pipette gun to gently pump up and down to mix well, resuspend the cells, and centrifuge at 3000g at 4°C for 5 minutes; discard the supernatant, add 750μl ice-cold 10% glycerol , gently pump up and down with a pipette to resuspend the cells, and centrifuge at 3000g at 4°C for 5 minutes; add 20 μl of ice-cold 10% glycerol, and gently pump up and down with a pipette to resuspend the cells Suspended, used immediately or immedia...

Embodiment 3

[0088] Example 3: Analysis of Practical Sequencing Applications

[0089]In order to test the actual effect of the fi gene knockout mutant strain of Escherichia coli DH5α on sequencing, we randomly selected a segment of the "shotgun non-clonable fragment" on the genome of Pseudomonas aeruginosa phage PaP1, used DH5αΔnfi as the cloning host strain, and used The shotgun strategy was used to clone and build a library, and finally successfully spliced ​​this fragment that could not be cloned by the traditional shotgun method.

[0090]

[0091]

[0092]

[0093]

[0094]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as a preparation method and application thereof. As for the mutant strain DH5 alpha delta nfi, the conservation number is CGMCC No.4236. The preparation method of the mutant strain comprises the following steps: carrying out gene knockout on EndoV coded on chromosomes of an E.coli DH5 alpha strainby using a lambda homologous recombination technology; and determining that the obtained strain is a gene-knocked-out mutant strain through confirmation of electrophoresis and sequencing identification of polymerase chain reaction (PCR) products, and naming the obtained gene to be DH5 alpha delta nfi. In the invention, the mutant strain is taken as clone host bacteria, and shotgun sequencing splicing is carried out 'no-cloning fragments' of pseudomonas aeruginosa bacteriophage PaP1 genome difficult to detect by a shotgun method, thus, the 'no-cloning fragments' can be successfully obtained. The success shows that the mutant strain can be utilized to solve the problem that deoxyribonucleic acid (DNA) sequencing or / and cloning is / are difficult to realize by using the traditional shotgun method.

Description

technical field [0001] The invention belongs to bacteria, and specifically relates to a method for preparing an nfi gene knockout mutant strain of Escherichia coli (Escherichia coli) DH5α, and its application in sequencing and / or cloning research of difficult-to-sequence DNA by shotgun method. Background technique [0002] Escherichia coli DH5α (abbreviated as E.coli DH5α) is an important model engineering strain and a derivative strain of Escherichia coli K-12, a commonly used recipient cell in molecular cloning technology. It plays an important role in the research fields of molecular biology, microbiology, cell biology and genetics. Escherichia coli DH5α is also the most commonly used host bacteria in traditional shotgun sequencing, and has made important contributions to the genome sequencing of various species. [0003] However, the traditional shotgun sequencing strategy is not suitable for all genomic DNA. For example, the genomic DNA of some phages and viruses often...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/09C12Q1/68C12Q1/02C12R1/19
Inventor胡福泉卢曙光李明乐率饶贤才
OwnerARMY MEDICAL UNIV