Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof

A lipase, animal body technology, applied in the field of lipase, can solve the problems of poor digestibility, low lipase activity, low digestibility, etc.

Inactive Publication Date: 2011-08-17
SHENZHEN LEVEKING BIOLOGY ENG
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The activity of lipase in poultry pancreas is very low at birth, and gradually increases with the increase of age after birth. The digestibility of animal fat in broiler chickens is very poor at birth, and gradually increases at the age of 1-8 weeks. Higher digestibility than animal oils, but lower in the first two weeks of chick life

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof
  • Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof
  • Lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, the construction of overexpression vector

[0032] Take the following steps:

[0033] (1) utilize restriction endonuclease Sac I, Kpn I to hygromycin resistance expression cassette from plasmid PV2 + Enzymatic cleavage (such as figure 1 shown), the fragment was recovered by gel, and cloned into the pCAMBIA2300 plasmid (such as figure 2 Shown), the recombinant plasmid pCHAMBIA2302 with hygromycin resistance was obtained (such as image 3 shown); the hygromycin expression cassette can also be derived from any other DNA containing this sequence or directly synthesized, and the plasmid used to construct the PEL gene overexpression vector can also be expressed in filamentous fungi such as pCAMBIA1300 except for pCAMBIA2300 , pCAMBIA3300 and other pCAMBIA series vectors and pHB vectors;

[0034] (2) According to the sequence design primer (forward primer: TG) of the lipase gene PEL (AF330635) of Penicillium expanded ACTAGT ATGTTGTTCAACTACCAATCTTT The und...

Embodiment 2

[0041] Embodiment two, the acquisition of Penicillium genetically engineered bacteria

[0042] The activity of described Penicillium genetically engineered bacterium comprises the steps:

[0043] (1) Pick the isolated and purified wild-type Penicillium and inoculate it on a PDA plate, cultivate it at 28°C for about 20 days, and wash the mature spores with sterile water;

[0044] (2) Inoculate the engineered Agrobacterium EHA105 containing the final vector pCHAMBIA2302::PgpdA-PEL-TtrpC in Example 1 in the LB liquid medium containing streptomycin and kanamycin (both 100 μg / ml) at 28°C, Cultivate overnight at 200 rpm, reactivate with MM medium containing streptomycin and kanamycin (both 100 μg / ml), and culture at 220 rpm for 48 hours at 28°C. Take an appropriate amount of culture and centrifuge at 5000rpm to remove the supernatant, wash with 1M liquid medium, and finally dilute to OD600=0.15 with 1M liquid medium, then cultivate at 28°C and 220rpm for 6-8 hours until OD600=0.5- ...

Embodiment 3

[0052] Embodiment 3, the comparison experiment of producing lipase ability

[0053] Randomly select the Penicillium genetically engineered bacterium that example 2 gained is inoculated on the PDA medium, insert in the seed culture medium 50mL respectively after cultivating 10 days, at 28 ℃, 210rpm shaker culture 24h, then transfer to respectively with 10% inoculum amount Fermentation medium (30mL fermentation medium in 250mL Erlenmeyer flask) was fermented at 28°C and 210rpm for 48h; then the fermentation broth was centrifuged, and the supernatant was taken for lipase activity detection.

[0054] The lipase activity was detected by acid-base titration.

[0055] step:

[0056] Take 20 100mL Erlenmeyer flasks, add 4.0mL Gly-NaOH buffer solution with pH 9.4 and 5.0mL olive oil emulsion respectively; put them into a oscillating constant temperature water bath at 36°C to preheat for 5 minutes. After filtering the enzyme solution, use 0.05 mol / L Gly-NaOH buffer solution of pH 9.4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention applies for providing lipase capable of reducing cholesterol and blood fat levels in bodies of animals and use thereof. Researches on the influences of the addition of the lipase in daily rations on the growth property, apparent metabolizable energy, blood biochemical indexes and abdominal fat rate of commercial broiler chicken are performed. The results of the researches indicate that the addition of the lipase can improve the growth property and apparent metabolizable energy of boiler chicken and reduce the content of triglyceride, low-density lipoprotein and high-density lipoprotein in blood and abdominal fat rate and that the improvement on the e growth property and apparent metabolizable energy and the reduction in the triglyceride, low-density lipoprotein, high-density lipoprotein and abdominal fat rate reach the greatest extend in the middle term of a test.

Description

technical field [0001] The application of the present invention relates to a lipase capable of effectively reducing cholesterol and blood lipid levels in animals and its application, and belongs to the field of biotechnology. Background technique [0002] Lipase, also known as triglyceride hydrolase, is a class of enzymes that can catalyze the hydrolysis of long-chain fatty acid glycerides, and can also catalyze the reverse reaction of this reaction. Lipases secreted by many microorganisms can also catalyze esterification reactions, transesterification reactions, Alcoholysis reaction, acidolysis reaction and ammonolysis reaction, etc. [0003] The activity of lipase in poultry pancreas is very low at birth, and gradually increases with the increase of age after birth. The digestibility of animal fat in broiler chickens is very poor at birth, and gradually increases at the age of 1-8 weeks. The digestibility of animal oil is higher than that of animal oil, but the digestibil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/20C12N15/55C12N15/80A61K38/46A61P3/06A23K1/165A23K20/189
Inventor 王剑英陈健张清辉
Owner SHENZHEN LEVEKING BIOLOGY ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com