Method for detecting mitochondrial mutations and kit thereof
A technology of mitochondria and kits, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of high cost, long cycle, cumbersome operation, etc., and achieve the effects of avoiding pollution, short time, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0023] 1. Primer design
[0024] 1.1 Using the human mitochondrial genome nucleic acid sequence (NCBI database sequence NC_012920) as a template, design 1555A->G and 1494C->T mutant primers, so that the 3' ends of the primers are completely matched with 1555G and 1494T mutants, but with wild-type If there is no match, design an upstream primer shared with these two primers at the same time.
[0025] 1.2 In order to distinguish the Tm values of the two amplified products on the melting curve, a sequence with high GC content was added at the 5' of the primer at position 1494.
[0026] 1.3 In order to ensure the validity of each detection, a pair of quality control primers was designed, and at the same time, it was ensured that the Tm value of the product could be distinguished from the other two detection peaks on the melting curve.
[0027] 1494 downstream primer: GCGGGCAGGGCGGCCTTTGAAGTATACTTGAGGAGA (Sequence 1), located between 1494-1514pb of the nucleic acid sequence, the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap