Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof
A technology of differential diagnosis and kit, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc. It can solve the problems of distinguishing between attenuated virus immunity and wild virus infection detection methods, and achieve negative and positive results The effect of obvious difference, good activity and sensitive result judgment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment
[0035] 1. Cloning of goat pox virus ORF95 and ORF103 genes and construction of prokaryotic expression vectors
[0036] The specific primers of ORF95 and ORF103 genes were designed with reference to the genome sequence of sheeppox virus in GenBank (AY077832). The primer sequences are:
[0037] ORF95: Upstream Primer: ACC GAATTC ATGGACTTCATGAAAAAATATACT, the underlined part is the EcoRI restriction site;
[0038] Downstream primer: ACC AAGCTT TTTGCTGTTATTATCATCCAG, the underlined part is the HindIII restriction site;
[0039] ORF103: Upstream primer: ACC GAATTC ATGTCTGATAAAAAATTATCTCG, the underlined part is the EcoRI restriction site;
[0040] Downstream primer: ACC AAGCTT ATCCATACCATCGTCGATAG, the underlined part is the HindIII restriction site;
[0041] ORF95 with a size of 483bp and ORF103 with a size of 570bp were amplified by PCR, ligated with the pET30a(+) expression vector after enzyme digestion, and prokaryotic expression vectors pET-95 and pET-103 were constr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
