Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof

A technology of differential diagnosis and kit, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc. It can solve the problems of distinguishing between attenuated virus immunity and wild virus infection detection methods, and achieve negative and positive results The effect of obvious difference, good activity and sensitive result judgment

Inactive Publication Date: 2011-09-14
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the key to antibody detection of sheeppox is whether it can effectively avoid the interference caused by the attenuated vaccine. At present, there is no detection method that can distinguish attenuated immunity from wild virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof
  • Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof
  • Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0035] 1. Cloning of goat pox virus ORF95 and ORF103 genes and construction of prokaryotic expression vectors

[0036] The specific primers of ORF95 and ORF103 genes were designed with reference to the genome sequence of sheeppox virus in GenBank (AY077832). The primer sequences are:

[0037] ORF95: Upstream Primer: ACC GAATTC ATGGACTTCATGAAAAAATATACT, the underlined part is the EcoRI restriction site;

[0038] Downstream primer: ACC AAGCTT TTTGCTGTTATTATCATCCAG, the underlined part is the HindIII restriction site;

[0039] ORF103: Upstream primer: ACC GAATTC ATGTCTGATAAAAAATTATCTCG, the underlined part is the EcoRI restriction site;

[0040] Downstream primer: ACC AAGCTT ATCCATACCATCGTCGATAG, the underlined part is the HindIII restriction site;

[0041] ORF95 with a size of 483bp and ORF103 with a size of 570bp were amplified by PCR, ligated with the pET30a(+) expression vector after enzyme digestion, and prokaryotic expression vectors pET-95 and pET-103 were constr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ELISA (Enzyme-Linked Immunosorbent Assay) antibody detection kit for distinguishing and diagnosing capripox field virus infection. The indirect ELISA antibody detection kit for distinguishing and diagnosing capripox field virus infection, disclosed by the invention, is internally provided with a coated antigen ELISA antibody detection board and an ELIAS secondary antibody, wherein the coated antigen is a mixture of a recombination capripox virus ORF95 protein and an ORF103 protein. The recombination proteins of ORF95 and ORF103, adopted by the invention, are convenient to prepare and purify in large quantities. The kit disclosed by the invention has a strong specificity, can effectively exclude the interference of the capripox attenuated-vaccine immunity, and specifically detects the capripox field virus infection.

Description

technical field [0001] The invention relates to a diagnostic kit, specifically an ELISA antibody detection kit for differential diagnosis of sheeppox wild virus infection. The kit includes an antigen-coated ELISA antibody detection plate and an enzyme-labeled secondary antibody. Background technique [0002] Capripox, also known as sheep "smallpox", is an acute, febrile, contact infectious disease caused by capripox virus. Hansen first reported goat pox in Norway in 1879, and the prevalence of sheep pox and goat pox was discovered in my country in the 1940s. Goat pox virus can cause goat pox, sheep pox and bovine nodular rash disease (lumpy skin disease, LSD). Herpes, visceral lesions (especially lung) and even death. Sheep pox is the most pathogenic of all animal pox viruses and is highly contagious, causing abortion in pregnant ewes, death of lambs, and atypical symptoms And secondary, concurrent infection, is listed as A class serious infectious disease by World Organizat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/543C12N15/39C12N15/70C07K14/065
Inventor 才学鹏朱学亮刘振勇骆学农窦永喜李辉
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More