Process for the enzymatic production of cyclic diguanosine monophosphate employing a diguanylate cyclase comprising a mutated rxxd motif

A technology of guanylate cyclase and guanosine triphosphate, which is applied in the production of bulk chemicals, biochemical equipment and methods, organic chemistry, etc., and can solve the problems that there is no industrial scale to produce c-di-GMP

Inactive Publication Date: 2011-11-16
INTERVET INT BV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Thus, some yield improvement can be obtained by preventing feedback inhibition, the disclosed syntheses generally lead to milligram scale laboratory scale production and do not allow the production of c-di-GMP on a practical, industrial scale

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for the enzymatic production of cyclic diguanosine monophosphate employing a diguanylate cyclase comprising a mutated rxxd motif

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] This example describes the cloning, overexpression, purification and characterization of genes for guanylate kinase and nucleoside diphosphate kinase from E. coli.

[0048] a) Gene cloning of Escherichia coli gmpk and Escherichia coli ndk

[0049] Based on the gene database DNA sequences of Escherichia coli GmpK (M84400) and Escherichia coli NdK (X57555), primers for PCR amplification of each gene were designed:

[0050] Ec-gmpK-Forward G GGATCC ATGGCTCAAGGCACGCTTTATATTGTTTCTG

[0051] Ec-gmpK-reverse G AAGCTT CAGTCTGCCAACAATTTGCTG

[0052] Ec-ndk-Forward G GGATCC ATGGCTATTGAACGTACTTTTTTCCATC

[0053] Ec-ndk-reverse G AAGCTT AACGGGTGCGCGGGCACACTTC

[0054] The underlined part is the introduced cloning site. The start and stop codons of the genes are in bold.

[0055]Genomic DNA was isolated from E. coli JM109 by standard methods (Joseph Sambrook and David W. Russell. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Ha...

Embodiment 2

[0063] a) Gene cloning of C. crescentus dgcA

[0064] Based on the gene database DNA sequence of Caulobacter crescentus dgcA (cc_3285; ACCESSION AE005673), primers for PCR amplification of each gene were designed:

[0065] Cacr-002 CAGAAGCGTTGTCGTGCCCATGGTTG

[0066] Cacr-004 TTGCAGGCCAATGTGGTCATGGGCGGCATCGTCGGCCGCATGGG

[0067] Cacr-010 GG TCTAGA ATGAAAATCTCAGGCGCCCGGACC

[0068] Cacr-011 CA GGATCC CGATCAAGCGCTCCTG

[0069] Cacr-014 GG TCTAGACATATG AAAATCTCAGGCGCCCGGA

[0070] The underlined part is the introduced cloning site. The start codon of dgcA is in bold.

[0071] PCR was performed in standard PCR (35 cycles, 30 sec extension time, annealing temperature 55° C.) using 4 ng / ml genomic DNA of C. crescentus CB15 template and 1.0 μΜ primers Cacr-002 / Cacr-004. The expected DNA band representing the 3'-end of the dgcA gene including the R153V-E154M-S155G-D155G mutation was observed after 1% TBE agarose gel electrophoresis. Excise each PCR band, purify the DNA fr...

Embodiment 3

[0077] This example illustrates the production of c-di-GMP from GMP.

[0078] 1250ml freshly refolded DgcA, 5000U NdK (2.8U / μl in 50% glycerol), 5000U GmpK (3.6U / μl in 50% glycerol), guanosine 5'-monophosphate (GMP, 4g, 11mmol), 13.75 g Adenosine 5' disodium triphosphate (ATP) was mixed with 3750 ml of reaction buffer containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl and incubated at 30 °C for 16 hours with gentle shaking at 80 rpm 2 , 0.5 mM EDTA and 50 mM NaCl.

[0079] purification

[0080] The crude reaction mixture (4800ml) was filtered through cellulose and added to an anion exchange column (Dowex 1 x 2, 400ml Pharmacia XK26, 2.5cm inner diameter, about 70cm long; Cl -Type, washed thoroughly with 0.5% acetic acid, equilibrated with water (2000ml; flow rate 10ml / min) on.

[0081] Water (2000ml, 10ml / min), 2M NH 4 OAc (2000ml, 10ml / min), water (1500ml, 10ml / min), 10mM HCl / 50mM LiCl (1000ml, 10ml / min) washed the column.

[0082] The product was eluted from the anion exchan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

A process is disclosed for the production of cyclic di-guanosine monophosphate (c-di-GMP) without the use of protecting groups by means of an enzymatic synthesis. The process comprises the coupling of two guanosine triphosphate (GTP) molecules so as to form a c-di-GMP molecule. This is done under the influence of a mutant diguanylate cyclase (DGC) comprising the amino acid sequence V153M154G155G156. It has been found that the DGC is obtainable from inclusion bodies, and therewith can be made available in amounts sufficient to improve the c-di-GMP synthesis. Particularly, the latter synthesis can be conducted in a one-pot method starting from commercially available bulk chemicals and allows upscaling to a commercial production scale.

Description

field of invention [0001] The present invention relates to the enzymatic synthesis of cyclic diguanosine monophosphate (c-di-GMP) through the coupling of two guanosine triphosphate (GTP) molecules under the influence of diguanylate cyclase (DGC) field. In particular, the present invention relates to providing large-scale sources of DGC. Furthermore, the present invention relates to the production of c-di-GMP on an industrial scale. Background of the invention [0002] Cyclic diguanosine monophosphate (c-di-GMP) is a bacterial second messenger involved in biofilm formation, antibiotic resistance and the persistence of pathogenic bacteria in their animal hosts. [0003] Thus, WO2005 / 030186 relates to the use of c-di-GMP in a method for attenuating the virulence of microbial pathogens or for inhibiting or reducing colonization by microbial pathogens. US2005 / 0203051 relates to the use of c-di-GMP for inhibiting cancer cell proliferation or increasing cancer cell apoptosis. U...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12P19/36C07H19/207
CPCC12N9/1241C12P19/36C07H19/207C12N15/52Y02P20/55C12N9/88C12N15/63C12P1/00
Inventor T·S·埃尔葛V·斯佩尔R·瓦拉斯
Owner INTERVET INT BV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap