Fusion protein of interleukin-3 derived fragment and purpose thereof

An interleukin and fusion protein technology, which is used in medical preparations with non-active ingredients, DNA/RNA fragments, and cells modified by introducing foreign genetic material, etc. It can solve shock and cell killing without tumor cell specificity. , prone to recurrence, etc.

Active Publication Date: 2012-02-01
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional chemotherapy and radiotherapy have two major defects: one is the serious side effects of the drug, and the other is that it is easy to relapse after treatment
This is because the cell killing effect it produces is not specific to tumor cells and can cause serious toxic side effects to the human body; at the same time, as a human heterologous protein, it also has strong immunogenicity, which can not only lead to the rapid production of antibodies and make it It is neutralized and inactivated, and can cause severe allergic reactions in the human body, even shock and death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of interleukin-3 derived fragment and purpose thereof
  • Fusion protein of interleukin-3 derived fragment and purpose thereof
  • Fusion protein of interleukin-3 derived fragment and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0143] Example 1 IL2 encoding fusion protein non-viral vector m Acquisition of gene fragments

[0144] The present invention uses the qmIL2-pG vector (described in detail in the description of the patent application number 200610112334.3) as a template to design external primers (primer sequence as shown in SEQ ID NO.17) and upstream and downstream primers (primer sequence as shown in SEQ ID NO. .18 and 19) introduce Nde I restriction site sequence CATATG and initiation codon AUG at the 5' end, and introduce fusion protein linker (G 4 SG 4 T) sequence GGTGGCGGAGGTTCTGGTGGC GGTGGAACC, the IL2 gene coding that has mutated by overlapping PCR amplification obtains fragment NdeI-(IL2 m +linker)-, the size is 368bps. The total volume of the overlapping PCR reaction system is 60 μl, and the composition is: System I: 0.5-1 μg of DNA template, 4 μl of dNTPs (2mM), 0.25 μl of Pfu DNA polymerase (2U / μl), 10×PCR Buffer (20mMMg 2+ ) 5 μl, upstream primer (10 μM) 2 μl, downstream ...

Embodiment 2

[0145] The acquisition of the SON3 gene segment of embodiment 2 coding fusion protein non-viral vector

[0146] The present invention uses the NCBI accession number as the SON protein coding nucleotide of NM_032195 as a template to design external primers (primer sequences shown in SEQ ID NO.20) and upstream and downstream primers (primer sequences shown in SEQ ID NO.21 and 22) ) into the fusion protein linker (G at the 5' end 4 TG 4 T) The coding sequence GGTGGCGGCGGTACCGGTGGTGGCGGAACT and the basic amino acid KRKRS coding sequence AAACGCAAGCGTAGC, the BamH I restriction site sequence GGATCC was introduced at the 3' end, and the fragment (linker-SON3)-BamH I- was obtained by OVERLAP-PCR, the size was 237bps, agarose Gel electrophoresis confirmed that the obtained fragment sizes were in line with expectations.

Embodiment 3

[0147] Example 3 Prokaryotic expression of recombinant pCW-IL2 m Construction of SON3 expression recombinant

[0148] The present invention uses the IL2 obtained in Example 1 m With the SON3 obtained in Example 2 as a template, design external primers (primer sequence as shown in SEQ ID NO.23) and upstream and downstream primers (primer sequence as shown in SEQ ID NO.24 and 25) to carry out overlapping PCR to connect, Amplify DNA fragments. After recovery and purification, double digestion with BamH I and Nde I, the same double digestion of the pCW111 prokaryotic expression vector, ligation of the vector fragments according to the enzyme connection ratio, construction of pCW-IL2 m SON3 expression recombinant. For the recombinant construction process, see figure 1 , agarose gel electrophoresis confirmed that the obtained fragment sizes were in line with expectations.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to fusion protein of an interleukin-3 derived fragment and a purpose thereof. Particularly, the invention relates to fusion protein containing mutated interleukin-3 derived fragment, which is selected from: (1) IL2mIL3m2SON3, (2) IL2mIL3m3SON3 or (3) IL2mIL3m1SON3, wherein IL2m is an IL2-mutated derived fragment, IL3m2 is an IL3-mutated derived fragment 2, IL3m3 is an IL3-mutated derived fragment 3, and IL3m1 is an IL3-mutated derived fragment 1, and SON3 is a DNA-binding protein SON derivative fragment and is rich in basic amino acids. The invention also related to the purpose of the fusion protein, an encoding nucleotide sequence, a recombinant containing the encoding nucleotide sequence, an engineering cell or engineering bacteria containing the recombinant, a method for production of the fusion protein, a composition of the fusion protein, a compound of the fusion protein, and a purpose of the compound. The invention provides a drug with a fully new mechanism for killing and / or eliminating ordinary leukemia cells and leukemia stem cells.

Description

technical field [0001] The present invention relates to the fusion protein of interleukin 3 derivative fragment and its application. More specifically, the present invention relates to a fusion protein comprising a mutant modified interleukin 3-derived fragment selected from: (1) IL2 m IL3 m2 SON3, (2) IL2 m IL3 m3 SON3 or (3)IL2 m IL3 m1 SON3, where IL2 m Is a derivative fragment of the mutant modification of IL2, IL3 m2 is a mutant derivative of IL3 derived fragment 2, IL3 m3 is a mutant derivative of IL3 fragment 3, IL3 m1 It is a derivative fragment 1 of the mutation modification of IL3, and SON3 is a derivative fragment of the DNA binding protein SON and is rich in basic amino acids. In particular, the present invention also relates to the use of the above-mentioned fusion protein, the coding nucleotide sequence, the expression recombinant containing the coding nucleotide sequence, the engineering cell or engineering bacteria containing the above-mentioned recomb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12P21/02A61K48/00A61K47/48A61P35/02A61K47/42
Inventor卢圣栋肖卫纯王湛卢丽陈伟京李涛王欣路金芝
OwnerTHE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI