Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Achromobacter and method for asymmetrically catalytically reducing carbon-carbon double bond

A colorless bacillus, carbon-carbon double bond technology, applied in the field of biochemistry, to achieve the effect of easy preparation and mild reaction conditions

Inactive Publication Date: 2012-07-11
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first asymmetric catalytic reduction of carbon-carbon double bonds for Achromobacter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Achromobacter and method for asymmetrically catalytically reducing carbon-carbon double bond
  • Achromobacter and method for asymmetrically catalytically reducing carbon-carbon double bond
  • Achromobacter and method for asymmetrically catalytically reducing carbon-carbon double bond

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 strain screening

[0026] Get 1 gram of soil sample and join into 50ml inorganic salt culture fluid (composition is as follows: KH 2 PO 4 0.1g / 100mL, Na 2 HPO 4 0.2g / 100mL, MgCl 2 0.04g / 100mL, NH 4 Cl 0.04g / 100mL), then add 100 μL of citral; another 1 gram of soil sample is added to 50ml of inorganic salt culture solution (the composition is as follows: KH 2 PO 4 0.1g / 100mL, Na 2 HPO 4 0.2g / 100mL, MgCl 2 0.04g / 100mL, NH 4Cl 0.04g / 100mL), add 100μL of (Z)-2-phenylbut-2-enenitrile; respectively enrich culture (30°C, 230rpm), take out 1mL each after 7 days under the same conditions The secondary enrichment culture was carried out for 8 days. Then add double distilled water 9mL to dilute and coat the plate, (the components of the plate medium are: tryptone 1g / 100mL; yeast extract 0.5g / 100mL; NaCl 1g / 100mL; agar powder 2g / 100mL, and each plate 100 μL each of citral or (Z)-2-phenylbut-2-enenitrile) was coated on the surface, cultured in a consta...

Embodiment 2

[0033] Conversion substrate (Z)-3-phenyl-3-cyano-acrylic acid during the screening of Example 2 Achromobacter JA81

[0034] The chiral 3-aryl-3-cyanopropionic acid catalyzed by JA81 is an intermediate in the synthesis of γ-aminobutyric acid. γ-Aminobutyric acid (GABA) is the most important inhibitory amino acid transmitter in the mammalian central nervous system (Fryszkowska et al.2010A short, chemoenzymatic route to chiral beta-aryl-gamma-amino acids using reductases from anaerobic bacteria.Org Biomol Chem 8:533-535). See the content of the invention in this manual for the cultivation method of the seeds and the composition of the culture medium. Take 1 g of freshly cultured wet bacteria, suspend in 10 mL of potassium phosphate buffer (0.1 M, pH 7.0), add 500 μL of isopropanol, 500 mg of glucose and 10 mg of (Z)-3-phenyl-3-cyano-acrylic acid ( The substrate is dissolved in dimethyl sulfoxide, and the dosage is 100g / L). Shake the reaction on a shaker (30°C, 230rpm) for 48 h...

Embodiment 3

[0035] The identification of embodiment 3 screening bacterial strains

[0036] In order to determine the taxonomic status of the strain, the strain was initially identified by 16S rRNA.

[0037] 16S rRNA identification: Genomic DNA was used as a template to amplify the 16S rRNA sequence with bacterial universal primers NS1 and NS8. Its sequence is as follows (1524bp):

[0038] AGAGTTTGATCCTGGCTCAGATTGAACGCTAGCGGGATGCCTTACACATGCAAGTCGAA

[0039] CGGCAGCACGGACTTCGGTCTGGTGGCGAGTGGCGAACGGGTGAGTAATGTATCGGAA

[0040] CGTGCCTAGTAGCGGGGGATAACTACGCGAAAGCGTAGCTAATACCGCATACGCCCTAC

[0041] GGGGGAAAGCAGGGGATCGCAAGACCTTGCACTATTAGAGCGGCCGATATCGGATTAGC

[0042] TAGTTGGTGGGGTAACGGCTCACCAAGGCGACGATCCGTAGCTGGTTTGAGAGGACGA

[0043] CCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAA

[0044] TTTTGGACAATGGGGGAAACCCTGATCCAGCCATCCCGCGTGTGCGATGAAGGCCTTCG

[0045] GGTTGTAAAGCACTTTTGGCAGGAAAGAAACGTCATGGGTTAATACCCCGTGAAACTGA

[0046] CGGTACCTGCAGAATAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTAATAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biochemistry and particularly relates to achromobacter sp. JA81 with the collection number of CCTCC M 2011369 and a method for obtaining an electron-deficient alkane compound by converting (Z)-3-aryl-3-cyan-crylic acid, annular imide and unsaturated nitro compounds by using the achromobacter as a biocatalyst. In the method, the maximum enantiomeric excess reaches over 99 percent and the highest conversion ratio reaches 100 percent. The catalyst achromobacter is easy to prepare and mild in reaction condition, and is one of the effective methods for preparing a chiral electron-deficient alkane compound in an environment-friendly manner.

Description

technical field [0001] The invention belongs to the technical field of biochemistry, and specifically relates to a colorless bacillus and the use of the bacteria to transform (Z)-3-aryl-3-cyano-acrylic acid, cyclic imides and unsaturated nitro compounds to prepare optically pure The method of electron-deficient alkane compounds is the first application of Achromobacter sp. to asymmetric catalytic reduction of carbon-carbon double bonds. Background technique [0002] Optically pure electron-deficient alkanes are important building blocks in organic synthesis and can be used to prepare optically pure chiral drugs. Carbon-carbon double bond reductase (enoate reductase) asymmetrically catalyzes the reduction of carbon-carbon double bonds with strong electron-withdrawing groups, and can simultaneously obtain optically pure electron-deficient alkane compounds with one or two chiral centers. One of the methods for preparing chiral electron-deficient alkanes (Stuermer et al. 2007 A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12P13/00C12R1/025
Inventor 吴中柳刘艳杰林晖
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com