Human anionic trypsin mutant

A technology of trypsin and anion, applied in the direction of enzymes, using carriers to introduce foreign genetic material, enzymes, etc., can solve the problems of low activity and poor stability of natural enzymes

Active Publication Date: 2015-05-20
上海雅心生物技术有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, due to the low activity and poor stability of natural enzymes, their application has been limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human anionic trypsin mutant
  • Human anionic trypsin mutant
  • Human anionic trypsin mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1, mutation site

[0082] The amino acid sequence of wild-type human anionic trypsinogen (hTg2) is as follows (SEQ ID NO: 2):

[0083] M N L L L I L T F V A A A V A A P F D D D D K I V G G Y I C E E N S V P Y Q V S L N S G Y H F C G G S L I S E Q W V V S A G H C Y R I Q V R L G E H N I E V L E G N E Q F I N A A K I I R H P K Y N S R T L D N D I L L I K L S S P A V I N S S A I S L P T A P P A A G T E S L I S G W G N T L S S G A D Y P D E L Q C L D A P V L S Q A E C E A S Y P G K I T N N M F C V G F L E G G K D S C Q G D S G G P V V S N G E L Q G I V S W G Y G C A Q K N R P G V Y T K V Y N Y V D W I K D T I A ​​A N S

[0084] The nucleotide sequence of wild-type human anionic trypsinogen (hTg2) is as follows (SEQ ID NO: 1):

[0085] GCTCCGTTTGACGATGACGACAAAATCGTGGGTGGTTACATCTGCGAGGAGAACTCCGTGCCGTACCAGGTTTCTCTCAATTCTGGCTACCACTTCTGCGGTGGCAGCCTGATCTCTGAACAGTGGGTAGTGTCTGCTGGCCATTGCTACAAGTCTCGTATCCAGGTACGTCTGGGTGAACACAACATCGAAGTACTCGAAGGCAACGAGCAGTTCATCAACGCT...

Embodiment 2

[0091] Embodiment 2, the expression of mhTg2 (R122L)

[0092] Add HindIII and BamHI restriction sites to both ends of the DNA sequence of the mutant obtained above, and insert the mutant DNA into the HindIII / BamHI site of the pET-32a expression vector after HindIII / BamHI digestion, and obtain The recombinant vector is called pET-32a-R122L.

[0093] In order to serve as a control, the present inventors also added HindIII and BamHI restriction sites to both ends of the DNA sequence of the wild-type human anionic trypsinogen (hTg2), respectively, and inserted the mutant DNA into Into the HindIII / BamHI site of the pET-32a expression vector, the obtained recombinant vector is called pET-32a-hTg2.

[0094] The recombinant vectors pET-32a-R122L and pET-32a-hTg2 were respectively transformed into competent Escherichia coli DH5α cells to obtain transformants, and the correctly inserted recombinant expression vectors were obtained by sequencing.

[0095] Pick the monoclonal colony on ...

Embodiment 3

[0097] Embodiment 3, the purification of mhTg2 (R122L)

[0098] The inclusion bodies of recombinant mhTg2(R122L) or hTg2 were refolded and activated to obtain active mhT2(R122L) mutein or hTg2 protein, respectively. The cell suspension was ultrasonically disrupted, and centrifuged at 12000 rpm for 10 min at low temperature. The supernatant was discarded, and the precipitate was fully washed with 0.5% Triton X-100 solution and 20mM Tris-HCl pH 8.0 buffer respectively. After dissolving the washed inclusion body with 8M Urea solution, slowly add it to the refolding solution (50mMpH8.0Tris-HCl, 10mM GSH, 5mM GSSG) for dilution and refolding, after 12h, add enterokinase (enterokinase: Recombinant protein) (w:w)=1:100) was activated for 2 hours to obtain activated trypsin.

[0099] Put the obtained active protein on the column, the equilibration and elution conditions are as follows: use a 2×15cm chromatographic column, load an appropriate amount of CM-FF cation exchange resin, eq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human anionic trypsin mutant and a coding gene thereof, and further discloses a carrier containing the coding gene and a host cell. Self degradation is not easy to occur on the human anionic trypsin mutant, and the human anionic trypsin mutant has strong enzymolysis capability, is strong in binding force with a substrate and tolerance capacity to severe environment.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to a human anionic trypsin (human trypsin 2) mutant. Background technique [0002] Trypsin (Trypsin, EC3.4.21.4) is synthesized in the pancreas in the form of trypsinogen, an enzyme precursor, and is secreted as a component of pancreatic juice. Active trypsin is an endopeptidase that can cut off the carboxyl side of lysine and arginine residues in the polypeptide chain. It not only acts as a digestive enzyme, but also restricts and decomposes the precursors of other enzymes such as chymotrypsinogen, carboxypeptidase, and phospholipase, and activates it. It is the most specific protease and is important in protein sequencing. tool enzyme. [0003] Secretory fluid of the human pancreas contains two major forms of trypsinogen, the cationic (pI > 6.8) trypsinogen-1 and the anionic (pI < 6.8) trypsinogen-2. Both consist of 247 amino acids, including a sign...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/76C12N15/57C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12P21/06
Inventor李素霞冯矗赵致
Owner上海雅心生物技术有限公司