Specific expression promoter ProWOX11a of poplar root primordium and application thereof
A promoter, a specific technology, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Extracting Populus Nanlin 895 DNA
[0021] The DNA of Populus Nanlin 895 can be extracted by conventional methods, or the DNA of Populus Nanlin 895 can be extracted by using the Plant Genomic DNA Kit of TIANGEN Company, and the operation steps are slightly improved:
[0022] Draw 1mL of buffer solution GP1 into a 2mL centrifuge tube and preheat at 65°C; at the same time, take 100mg leaves of Populus Nanlin 895 tissue culture seedlings and grind them fully in liquid nitrogen; preheat GP1 buffer solution at 65°C in aliquots; quickly grind the finely ground sample powder Transfer to the preheated 1mL GP1 buffer (add 10μL β-mercaptoethanol to the preheated 1mL buffer GP1 before adding the sample), vigorously invert and mix, and then bathe in 65°C water for 20min; add 1mL chloroform, mix well, and centrifuge at 12000rmp for 5min Then transfer the upper aqueous phase to a new centrifuge tube; repeat this step once; add 1mL buffer GP2 to the centrifuge tube containin...
Embodiment 2
[0023] Example 2 Cloning of the ProWOX11a promoter
[0024] Taking Nanlin 895 poplar DNA (prepared in Example 1) as material, refer to poplar genome sequence information (http: / / www.phytozome.net / ), design specific primers to amplify the ProWOX11a promoter sequence. Among them, the specific primers include: ProWOX11a forward primer: 5'TGGACTCTTTCTCTCATCTCTGC 3' and ProWOX11a reverse primer: 5'TTCATCCTTTGGTGGGTTTAC 3'. The high-fidelity PCR reaction system is as follows: 10×LA PCR Buffer (Mg 2+ free) 5.0μL; 2.5mM dNTP Mixture 8.0μL; 25mM Mg 2+ 5.0 μL; LA Taq DNA Polymerase (5U / μL) 0.5 μL; ProWOX11a forward primer (10 μM) 2 μL; ProWOX11a reverse primer (10 μM) 2 μL; template (895 poplar DNA 1 μg / μL) 1 μL; add sterile ddH 2 O to make up 50 μL. Reaction program: pre-denaturation at 94°C, 3min; 94°C, 40s, 55°C, 30s, 72°C, 2min, 35 cycles; 72°C, 10min. The amplified product was sequenced to obtain the 1797bp sequence of the ProWOX11a promoter, as shown in SEQ NO1.
[0025] ...
Embodiment 3
[0033] Example 3 ProWOX11a promoter tissue-specific expression analysis
[0034] The constructed pBGGUS-ProWOX11a was transformed into Agrobacterium strain EHA105 (Invitrogen) by conventional liquid nitrogen freeze-thaw method, and the ProWOX11a promoter was transformed into Arabidopsis thaliana through Agrobacterium-mediated. The GUS staining results of T2 generation Arabidopsis plants transfected with ProWOX11a promoter vector are as follows: image 3 , 4 and 6, by using figure 2 and Figure 5 The comparison of the GUS staining diagrams of wild-type plants shows that the GUS gene is specifically expressed in the lateral root primordium and root tip meristem. Therefore, the promoter provided by the invention can be used to induce the corresponding target gene in the root primordium in plant genetic engineering. Specifically expressed in basal and root apical meristems.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More