Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants

A drought-resistant, genetic technology applied in the direction of microbial-based methods, applications, plant products, etc.

Active Publication Date: 2012-07-18
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although there may be an evolutionary synergy between radiation-tolerant strains and drought stress resistance, the function of the le...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants
  • Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants
  • Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0037] Expression of embodiment 1D.radiodurans R1lea-like gene (DR1172) sequence in Escherichia coli

[0038] Design a pair of PCR-specific primers based on the published sequence of the lea-like gene (DR1172) in the D. radiodurans R1 genome:

[0039] Up 5′ ATTA ACTAGT CGCAGCGTAGGCTCCTGACA 3

[0040] Down 5′ACGCCATATG ACTCAGTTCTTGCGGGTGTT 3

[0041] The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, [94°C for 60 sec, 55°C for 30 sec, 72°C for 60 sec] 30 cycles, 72°C for 10 min. After the PCR product was recovered by gel, it was cloned on the vector pGEMT-easy, named pGEMT-lea, and verified by sequencing; then the lea-like gene (DR1172) with cohesive ends and the promoter groEL were obtained by SpeI / NdeI double digestion. The pRADZ3 vector, the lea-like gene (DR1172) was connected to the pRAD Z3 vector, and the Escherichia coli expression vector pRADZ3-lea G was constructed, and the expression vector...

Embodiment 2

[0043]Example 2 Drought resistance experiment of recombinant strain containing D.radiodurans R1lea-like gene (DR1172)

[0044] 1. Experimental method

[0045] 1. The 2 recombinant Escherichia coli obtained in Example 1 were respectively inoculated in 20 mL of LB liquid medium (containing Amp antibiotics), and after shaking the flask for overnight culture (37° C.), they were then transferred to 100 mL of LB liquid medium , try to keep the inoculum size consistent, and cultivate until the OD600 is about 0.5 (try to keep the OD600 value consistent).

[0046] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , take 10 μL spots on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures (3M sorbitol is a hypertonic solution, which can simulate drought stress).

[0047] 2. Experiment...

Embodiment 3

[0051] Example 3 Expression of lea-like gene (DR1172) in rapeseed and identification of drought resistance of transgenic plants

[0052] (1) Agrobacterium-mediated transformation of rapeseed experiment

[0053] 1. Preparation of competent Agrobacterium tumefaciens EHA105

[0054] 1) Pick a single colony and inoculate it in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), and culture overnight at 28°C with shaking at 250rpm;

[0055] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), and culture at 28°C and 250rpm until OD 600 About 0.6 or so;

[0056] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;

[0057] 4) Discard the supernatant, use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.

[0058] 2. Transformation of recombinant plasmid DNA into Ag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention finds that a lea-like gene (DR1172) in Deinococcus radiodurans R1 has the function of improving the adversity resistance of prokaryotes and plants. The invention constructs recombinant vectors containing the gene and the recombinant vectors are respectively transferred into prokaryotic and eukaryotic host cells. Experiments prove that the lea-like gene (DR1172) can improve the drought resistance of the rapes after being expressed in the prokaryotic host cell and the rapes.

Description

technical field [0001] The invention relates to the new function of the lea-like gene of Deinococcus radiodurans R1, and specifically relates to the application of the gene in enhancing the resistance of plants to drought stress. Background technique [0002] The most common abiotic environmental stress suffered by crops is water shortage, and the loss of crops caused by drought ranks first among all abiotic stresses (Dracup et al., 1998). Deinococcus radiodurans R1 (D.radiodurans R1) has strong resistance to long-term desiccation and strong oxidative stress, so it has become an ideal strain for studying the adaptation mechanism of microorganisms to abiotic stress, and can also be used as a research tool for studying drought resistance of higher plants. model species (Battista et al., 2001). D. radiodurans R1 contains four proteins related to plant drought resistance, among which the protein encoded by lea-like gene DR1172 belongs to the LEA 3 family member and is closely r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/31C12N15/63C12N1/21C12N1/15C12N1/19C12N5/10A01H5/00C12R1/19
Inventor 陈明江世杰张维王劲郝艳华林敏
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap